View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_3 (Length: 538)

Name: NF0920_high_3
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_3
NF0920_high_3
[»] chr1 (1 HSPs)
chr1 (37-530)||(10794462-10794955)


Alignment Details
Target: chr1 (Bit Score: 470; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 470; E-Value: 0
Query Start/End: Original strand, 37 - 530
Target Start/End: Original strand, 10794462 - 10794955
Alignment:
37 tatataaagattttgttgatgaataatctgttaatgcatctttcaacgttcttaagaagtattttcgattttgttttttaatatatgatcatagaagcta 136  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||    
10794462 tatataaagattttgttgatgaataatatgttaatgcatctttcaacgttcttaagaagtattttcgattttgttttttaacatatgatcagagaagcta 10794561  T
137 cgcaaatagaatatggggtaattatgtgtcagaaaaaagaaagaatgtgggggttatttcttatttgagccaagattataacctaattgtgccaaaattc 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10794562 cgcaaatagaatatggggtaattatgtgtcagaaaaaagaaagaatgtgggggttatttcttatttgagccaagattataacctaattgtgccaaaattc 10794661  T
237 aaccaccaaatgaagccaaaatcaaattattgataatgaggtgtgaaggaatgtggatttatgcgcatagtggaccccacattttacaccagccacatgc 336  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
10794662 aaccaccaaatgaagccaaaatcaaattattgatattgaggtgtgaaggaatgtggatttatgcgcataatggaccccacattttacaccagccacatgc 10794761  T
337 taatggagttcacatttccaaaaaagatagacctctccaataaaggacaattagaacaagtgtccctcactccaattttctcaaaaccataattaaatat 436  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10794762 taatggagttcacatttccaaaaaagatagacctctccaataaaggacaattagaacaagtgtccctcactccaattttctcaaaaccataattaaatat 10794861  T
437 acctaaacccaaaagtcccttttacatatacatactttacattttcatatgtacctaacaacttaagaaatcctttactttcctcatattcttc 530  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
10794862 acctaaacccaaaagtcccttttacatatacatactttacattttcatatgtacctaacaacttaagaaatcctttactttcctcattttcttc 10794955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142214 times since January 2019
Visitors: 1479