View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_4 (Length: 440)

Name: NF0920_high_4
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_4
NF0920_high_4
[»] chr4 (10 HSPs)
chr4 (47-407)||(30264171-30264531)
chr4 (47-407)||(30287657-30288017)
chr4 (225-440)||(30032301-30032516)
chr4 (225-432)||(30048547-30048754)
chr4 (225-432)||(30062888-30063095)
chr4 (61-407)||(30280764-30281110)
chr4 (61-407)||(30304146-30304492)
chr4 (61-407)||(30271079-30271425)
chr4 (225-430)||(30228686-30228891)
chr4 (225-432)||(30220171-30220378)
[»] scaffold0024 (2 HSPs)
scaffold0024 (238-399)||(79534-79695)
scaffold0024 (274-399)||(72506-72631)
[»] chr7 (2 HSPs)
chr7 (225-337)||(2311376-2311488)
chr7 (226-326)||(29483193-29483293)


Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 10)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 47 - 407
Target Start/End: Original strand, 30264171 - 30264531
Alignment:
47 gcagaacctgtgaaccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaatt 146  Q
    |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
30264171 gcagaaactctgaaccttcctcaccattccatataggtgatttatcatcttcaattattgaacttttcaatatactccatccaaaatcagagattgaatt 30264270  T
147 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30264271 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 30264370  T
247 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcat 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30264371 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgtaagcagcat 30264470  T
347 tggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || |||||||||| ||||||| ||| ||||||||||| ||||| |||| |||||| |||||    
30264471 tgcttgttggatacttgataacatgtatttcccaaaggggtttgtcttttggtgtcctttc 30264531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 47 - 407
Target Start/End: Complemental strand, 30288017 - 30287657
Alignment:
47 gcagaacctgtgaaccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaatt 146  Q
    |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
30288017 gcagaaactctgaaccttcctcaccattccatataggtgatttatcatcttcaattattgaacttttcaatatactccatccaaaatcagagattgaatt 30287918  T
147 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30287917 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 30287818  T
247 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcat 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30287817 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgtaagcagcat 30287718  T
347 tggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || |||||||||| ||||||| ||| ||||||||||| ||||| |||| |||||| |||||    
30287717 tgcttgttggatacttgataacatgtatttcccaaaggggtttgtcttttggtgtcctttc 30287657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 225 - 440
Target Start/End: Original strand, 30032301 - 30032516
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
30032301 aggaaaagataaaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccgtcaccaagtgcatgatgaagtttg 30032400  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30032401 aatattatggtgcaagcttcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 30032500  T
425 catagtcattaaaata 440  Q
    ||||||||||||||||    
30032501 catagtcattaaaata 30032516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 225 - 432
Target Start/End: Original strand, 30048547 - 30048754
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
30048547 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtccatgatgaagtttg 30048646  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
30048647 aatattatggtgcaagcagcattggttgttggataattgataacatgaatttcccaaagtggtttatcttgtggtgtttttttagctagaatacttgtta 30048746  T
425 catagtca 432  Q
    ||||||||    
30048747 catagtca 30048754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 225 - 432
Target Start/End: Original strand, 30062888 - 30063095
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
30062888 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtccatgatgaagtttg 30062987  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
30062988 aatattatggtgcaagcagcattggttgttggataattgataacatgaatttcccaaagtggtttatcttgtggtgtttttttagctagaatacttgtta 30063087  T
425 catagtca 432  Q
    ||||||||    
30063088 catagtca 30063095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 61 - 407
Target Start/End: Complemental strand, 30281110 - 30280764
Alignment:
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| ||||||||    
30281110 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggagaata 30281011  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    |||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||||||||    
30281010 tggttgaaggaaaccacttgaaaaaacctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcagctct 30280911  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||| ||||||||||     
30280910 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcattgcttgttggatat 30280811  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30280810 ttaattaaatgcatttcccaaagtggtttgtcttgtggtgttctttc 30280764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 61 - 407
Target Start/End: Original strand, 30304146 - 30304492
Alignment:
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| || |||||    
30304146 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggggaata 30304245  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||| ||||    
30304246 tggttgaagggaaccacttgaaaaagcctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcaactct 30304345  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||| ||||||||||     
30304346 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcattgcttgttggatat 30304445  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30304446 ttaattaaatgcatttcccaaagtggtttgtcttgtggtgttctttc 30304492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 61 - 407
Target Start/End: Original strand, 30271079 - 30271425
Alignment:
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| ||||||||    
30271079 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggagaata 30271178  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    |||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||||||||    
30271179 tggttgaaggaaaccacttgaaaaaacctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcagctct 30271278  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||  ||||||||||     
30271279 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcatttcttgttggatat 30271378  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30271379 ttaattaaatgtatttcccaaagtggtttgtcttgtggtgttctttc 30271425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 225 - 430
Target Start/End: Original strand, 30228686 - 30228891
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
30228686 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcactcatgagagagtaaccatcaccaagtgcatgattaagtttg 30228785  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||  ||||||||||||||    
30228786 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttattttgtggtgttcttccatttagaatacttgtta 30228885  T
425 catagt 430  Q
    ||||||    
30228886 catagt 30228891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 225 - 432
Target Start/End: Complemental strand, 30220378 - 30220171
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30220378 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttg 30220279  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||| |  || |    ||||||| |||||||||| || || | ||||||||||||||| ||||||||||| |||||||||  || ||||||||||||||    
30220278 aatatcaaagttcctttagcattgcttgttggatatttaatcaaatgaatttcccaaaggggtttatcttgaggtgttcttgaagttagaatacttgtta 30220179  T
425 catagtca 432  Q
    ||||||||    
30220178 catagtca 30220171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 74; Significance: 9e-34; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 238 - 399
Target Start/End: Original strand, 79534 - 79695
Alignment:
238 ggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgc 337  Q
    ||||||||||| | ||||||||| |  | ||| |||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| || ||| |    
79534 ggaagagaagggttatcagctctttctaaacatgaaagaagtgcacccattagagagtaaccatctccaagtgcatgatgaagtttgaatactaaggtac 79633  T
338 aagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggt 399  Q
     ||| |||||  |||||||||| || |||||||| || |||||||||||| |||||||||||    
79634 cagctgcattttttgttggatatttaataatatgtatctcccaaagtggtctatcttgtggt 79695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 274 - 399
Target Start/End: Original strand, 72506 - 72631
Alignment:
274 agaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataattgataatatgaa 373  Q
    |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| || ||| | ||| |||||  |||||||||| || ||||||||||    
72506 agaagagctcccattagagagtaaccatctccaagtgcatgatgaagtttgaatactaaggtaccagctgcattttttgttggatatttaataatatgaa 72605  T
374 tttcccaaagtggtttatcttgtggt 399  Q
    ||||||| |||||| |||||||||||    
72606 tttcccatagtggtctatcttgtggt 72631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 225 - 337
Target Start/End: Complemental strand, 2311488 - 2311376
Alignment:
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||||||||||||||| ||||||||||| |  || |||||||||||||| |||||||| ||||| |||||||| ||||||||||| |||||||||    
2311488 aggaaaagacaaaggaagagatggatcatcagcacgttgtagacaagaaagaagtgcacccattagagaataaccatctccaagtgcatggtgaagtttg 2311389  T
325 aatattatggtgc 337  Q
    |||||||| ||||    
2311388 aatattattgtgc 2311376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 326
Target Start/End: Original strand, 29483193 - 29483293
Alignment:
226 ggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttga 325  Q
    ||||| |||||| | |||||||||||||||||||| ||||| |  |||||||   |||||||||||  ||| ||||| |||| |||||| |||| |||||    
29483193 ggaaaggacaaacggagagaaggatcatcagctctttgaaggctcgaaagaatgacacccatgagattgtagccatctccaattgcatggtgaaatttga 29483292  T
326 a 326  Q
    |    
29483293 a 29483293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149171 times since January 2019
Visitors: 1516