View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_5 (Length: 410)

Name: NF0920_high_5
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_5
NF0920_high_5
[»] chr4 (1 HSPs)
chr4 (80-237)||(22255683-22255840)
[»] chr1 (1 HSPs)
chr1 (80-237)||(38150665-38150822)
[»] chr8 (1 HSPs)
chr8 (80-221)||(5433529-5433671)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 80 - 237
Target Start/End: Original strand, 22255683 - 22255840
Alignment:
80 gaggagcagagattttatgatggtctgtcattactatattatttctttgcattgtcttcaacctcagattttaaaacctacaattaacctacatcaccat 179  Q
    |||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||    
22255683 gaggagcacatattttatgatggtctgtcattattatattatttctttgcattgtcttcaacctcagattttaaaacctgcaattaacctacaccaccat 22255782  T
180 caataactttaacctctattgcatgtccaattcaagcctctcttgaattagaacaaat 237  Q
    ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
22255783 caataactttaacctctattgcatgtccaatttgagcctctcttgaattagaacaaat 22255840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 80 - 237
Target Start/End: Complemental strand, 38150822 - 38150665
Alignment:
80 gaggagcagagattttatgatggtctgtcattactatattatttctttgcattgtcttcaacctcagattttaaaacctacaattaacctacatcaccat 179  Q
    |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| ||||| ||||||    
38150822 gaggagcacagattttatgatggtctgccattactatattatttctttgcattgtcttcaacctcagattttaaaaccagcaattaatctacaccaccat 38150723  T
180 caataactttaacctctattgcatgtccaattcaagcctctcttgaattagaacaaat 237  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
38150722 caataactttaacctctattgcatgtccaattcgagcctctcttgaattagaacaaat 38150665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 111; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 80 - 221
Target Start/End: Complemental strand, 5433671 - 5433529
Alignment:
80 gaggagcagagattttatgatggtctgtcattactatattatttctttgcatt-gtcttcaacctcagattttaaaacctacaattaacctacatcacca 178  Q
    |||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||| |||||    
5433671 gaggagcacatattttatgatggtctgtcattactatattatttctttgcatttgtcttcaacctcagattttaaaacgtgcaattaacctacaccacca 5433572  T
179 tcaataactttaacctctattgcatgtccaattcaagcctctc 221  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
5433571 tcaataactttaacctctattgcatgtccaattcgagcctctc 5433529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141983 times since January 2019
Visitors: 1479