View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_1 (Length: 664)

Name: NF0920_low_1
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_1
NF0920_low_1
[»] chr6 (1 HSPs)
chr6 (29-648)||(6095086-6095705)
[»] chr8 (1 HSPs)
chr8 (29-651)||(32805209-32805831)


Alignment Details
Target: chr6 (Bit Score: 572; Significance: 0; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 572; E-Value: 0
Query Start/End: Original strand, 29 - 648
Target Start/End: Original strand, 6095086 - 6095705
Alignment:
29 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 128  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
6095086 aataacaataggctcaaacacagattggttaaaaactagttggttcctatgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 6095185  T
129 tccggcgctgacagccacactttcatccacgatatcaactccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 228  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6095186 tccggcgctgacagccacactttcatccacgatatcaagtccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 6095285  T
229 ggcagcgcataaaaaggtgatccgagtcttctattaaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 328  Q
    |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6095286 ggcagcgcataaaaaggtgatctgagtcttctattgagaagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 6095385  T
329 tggaaggatattttttgccaacccccataagaaattttgtgcacttttagggacaggaatactccaaatacgcttccatatctcataattgttgctattt 428  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||    
6095386 tggaaggatattttttgtcaacctccataagaaattttgtgcacttttagggacgggagtactccaaatacgcttccatatctcagaattgttgctattt 6095485  T
429 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 528  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6095486 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 6095585  T
529 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctgctaaaaataagaccccggtcccactgatttgtatc 628  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
6095586 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctactaaaaataagaccccggtcccactgatttgtatc 6095685  T
629 cctatcaattaattccgcaa 648  Q
    ||||||||||||||||||||    
6095686 cctatcaattaattccgcaa 6095705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 571; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 571; E-Value: 0
Query Start/End: Original strand, 29 - 651
Target Start/End: Complemental strand, 32805831 - 32805209
Alignment:
29 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32805831 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 32805732  T
129 tccggcgctgacagccacactttcatccacgatatcaactccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 228  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32805731 tccggcgctgacagccacactttcatccacgatatcaagttcaattggttcggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 32805632  T
229 ggcagcgcataaaaaggtgatccgagtcttctattaaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32805631 ggcagcgcataaaaaggtgatccgagtcttctattgaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 32805532  T
329 tggaaggatattttttgccaacccccataagaaattttgtgcacttttagggacaggaatactccaaatacgcttccatatctcataattgttgctattt 428  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| ||||||||||||||    
32805531 tggaaggatattttttgccaacctccataagaaattttgtgcacttttagggacgggaatgctccaaatacgcttccaaatctcagaattgttgctattt 32805432  T
429 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 528  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32805431 gaggattcagcctgctctgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 32805332  T
529 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctgctaaaaataagaccccggtcccactgatttgtatc 628  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
32805331 ctgttggacgcctaacagataaagggatgcttatgattttcctggctatgtagttattgaacctgctaaaaataagaccccggtcccactgatttgtatc 32805232  T
629 cctatcaattaattccgcaacag 651  Q
    ||||||||||||||| |||||||    
32805231 cctatcaattaattctgcaacag 32805209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149163 times since January 2019
Visitors: 1516