View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_11 (Length: 376)

Name: NF0920_low_11
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_11
NF0920_low_11
[»] chr5 (1 HSPs)
chr5 (16-347)||(12350452-12350767)


Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 347
Target Start/End: Complemental strand, 12350767 - 12350452
Alignment:
16 acgacgatggcggaagaagaggcatggttgagcgcatgagaactgcgcccacataggagtatagcaaccccaaacagggtgaaaagatagcgcggagggg 115  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||    
12350767 acgacgatggcggaagaagaggcgtggttgagcgcatgagaactgcgcccacataagagtatagcaaccccaaacagggtgaaaagatagcgcagagggg 12350668  T
116 accttgttgcaccatcactgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga 215  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12350667 accttgttgcaccatcgctgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga 12350568  T
216 ggatatggatttagagagattttttggatcatgattgcatgccttcccaagtattagtgtactatgtgcatattagagacgagaaatcattaatcctcca 315  Q
    ||||||||||||||||||||||||||||||||||||     ||| |    ||       |||||||||||||||||||||||||||||||||||||||||    
12350567 ggatatggatttagagagattttttggatcatgatt-----cctcc----gt-------tactatgtgcatattagagacgagaaatcattaatcctcca 12350484  T
316 ttacccaatccaagtcaatcccttgaaatata 347  Q
    ||||||||||||||||||||||||||||||||    
12350483 ttacccaatccaagtcaatcccttgaaatata 12350452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142302 times since January 2019
Visitors: 1480