View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_13 (Length: 352)

Name: NF0920_low_13
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_13
NF0920_low_13
[»] chr8 (1 HSPs)
chr8 (30-339)||(41821111-41821420)


Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 41821111 - 41821420
Alignment:
30 agaagaagccttatgaggagaaataccaagctgaaaaagaggcttatttacaagtaattacaaaggaaaaacgtgaaattgaggcaatgaaactcttaga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
41821111 agaagaagccttatgaggagaaataccaagctgaaaaagaggcttatttgcaagtaattacaaaggaaaaacgtgaaattgaggcaatgaaactcttaga 41821210  T
130 agaggaacagaagcagaagactgctatggaattgcttgaacagtttatgcaattcaaacaagatgcagaaaaggagagcaagaagaacaagaaagagaag 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41821211 agaggaacagaagcagaagactgctatggaattgcttgaacagtttatgcaattcaaacaagatgcagaaaaggagagcaagaagaacaagaaagagaag 41821310  T
230 gatccattgaaaccaaagcatcctatgtcagcttttttcctgtttactaatgatagaagagcagccattcttgcagacaacaagggtatcttggaggtaa 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41821311 gatccattgaaaccaaagcatcctatgtcagcttttttcctgtttactaatgatagaagagcagctattcttgcagacaacaagggtatcttggaggtaa 41821410  T
330 ttgatgatat 339  Q
    ||||||||||    
41821411 ttgatgatat 41821420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142124 times since January 2019
Visitors: 1479