View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_14 (Length: 352)

Name: NF0920_low_14
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_14
NF0920_low_14
[»] chr3 (2 HSPs)
chr3 (12-287)||(42228526-42228802)
chr3 (265-346)||(42228803-42228884)


Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 287
Target Start/End: Original strand, 42228526 - 42228802
Alignment:
12 aagaaacttgtgacgcacataagatggattatct-cttccaaccaaattttttctatacgtatgactcaagaatcaaactcttgtccacgtacttaaacg 110  Q
    |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42228526 aagaaacttgtgacgcacataagatggactatcttcttccaaccaaattttttctatacgtatgactcaagaatcaaactcttgtccacgtacttaaacg 42228625  T
111 gttctagtactatatcacttcattaatctattgttggtctagtaacatatttttatcaaacgtggggtgtcgatctcttttgtcctaaaccactagtatg 210  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
42228626 gttctagtactatatcacttcattaatctattgttgatctagtaacatatttttatcaaacgtggcgtgtcgatctcttttgtcctaaaccactagtatg 42228725  T
211 ttgtatcttgttgatttagataaatttcaaccaattctcataaacattcatttggtcgtcgtgcctaggcgccacat 287  Q
    |||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||| ||| ||||    
42228726 ttgtatcttgttgatttagataaatttcaatcaattcttataaacattcatttgatcgtcgtgcctagacgcgacat 42228802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 265 - 346
Target Start/End: Original strand, 42228803 - 42228884
Alignment:
265 gtcgtcgtgcctaggcgccacatacatggcgaaacacagtcctgctatgcttgactaaagtcatagcaattttagaccaaca 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||    
42228803 gtcgtcgtgcctaggcgccacatacatggcgaaacacagtcctgctttgcttgactaaactcatagcaattttagacaaaca 42228884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136951 times since January 2019
Visitors: 1443