View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_15 (Length: 351)

Name: NF0920_low_15
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_15
NF0920_low_15
[»] chr4 (2 HSPs)
chr4 (57-310)||(49771805-49772058)
chr4 (137-310)||(8005291-8005455)


Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 57 - 310
Target Start/End: Original strand, 49771805 - 49772058
Alignment:
57 gttttttctatagtcacagtgaaattcaccggtgtatacttatatgcatgcatttttattacagcatgaaatcctcatggctcttagcacatgtttctcc 156  Q
    |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49771805 gttttttctatagtcagagtgaaattcaccggagtatacttatatgcatgcatttttattacagcatgaaatcctcatggctcttagcacatgtttctcc 49771904  T
157 taaaacccttggaaatcatgcaaagtgatatccaaaattaactatccatcttttgtgaatgccattgtattaagaagctactctgctttaagtatggtta 256  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
49771905 taaaacccttggatatcatgcaaagtgatatccaaaattaactatccatcttttgtgaatgccattgtattaagaagctactctgcttcaagtatggtta 49772004  T
257 cacttatttttgtactcatttttaagcaaagaatcaccttgacctttttacata 310  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||    
49772005 cacttatttttgtactaatttttaagcaaagaatcaccttgacctttttacata 49772058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 137 - 310
Target Start/End: Complemental strand, 8005455 - 8005291
Alignment:
137 ctcttagcacatgtttctcctaaaacccttggaaatcatgcaaagtgatatccaaaattaactatccatcttttgtgaatgccattgtattaagaagcta 236  Q
    |||| |||||||||||||||||||||||||||| ||||||| | |||||||| ||||||||||||||||||||| | ||||        |||||||||||    
8005455 ctctgagcacatgtttctcctaaaacccttggatatcatgcgatgtgatatcgaaaattaactatccatcttttataaatg--------ttaagaagcta 8005364  T
237 ctctgctttaagtatggttacacttatttttgtactcatttttaagcaaagaatcaccttgacctttttacata 310  Q
    |||||||| ||  || ||||||||| |||||||| | | ||||||| |||||||||||||||||||||||||||    
8005363 ctctgcttcaaacatagttacacttgtttttgta-ttaattttaaggaaagaatcaccttgacctttttacata 8005291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141879 times since January 2019
Visitors: 1478