View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_16 (Length: 339)

Name: NF0920_low_16
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_16
NF0920_low_16
[»] chr2 (1 HSPs)
chr2 (1-268)||(16501510-16501777)


Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 16501777 - 16501510
Alignment:
1 aaatacaaaaaagaataatgatcagttacaaactatcttacaagagaaagttttgagttctaataactaacaattgaagaaggaaatgctgcatctcatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16501777 aaatacaaaaaagaataatgatcagttacaaactatcttacaagagaaagttttgagttctaataactaacaattgaagaaggaaatgctgcatctcatt 16501678  T
101 ctaacgattgaaatgttctaaacttgcatattattaatcaaacatgaaaaaatacaaaagcgaattttattttcctcatacctctgacctttccaacctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16501677 ctaacgattgaaatgttctaaacttgcatattattaatcaaacatgaaaaaatacaaaagcgaattttattttcctcatacctctgacctttccaacctt 16501578  T
201 ctccagcgtaagcatcgataagattctgttcttgcttcattctgattaagatattccttgttcatctc 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
16501577 ctccagcgtaagcatcgataagattctgttcttgcttcattctgattaagatattccttgttcttctc 16501510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142505 times since January 2019
Visitors: 1480