View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_17 (Length: 301)

Name: NF0920_low_17
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_17
[»] chr2 (1 HSPs)
chr2 (75-251)||(15885913-15886089)

Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 75 - 251
Target Start/End: Complemental strand, 15886089 - 15885913
75 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 174  Q
15886089 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 15885990  T
175 agaggggtctccttgccttaaccctctaccagaaataaaaggaacaggtgtgctaccattaaacaaaatagaataat 251  Q
    |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    
15885989 agaggggtctccttgccttaaccctctaccaggaataaaaggtacaggtgtgctaccattaaacaaaatagaataat 15885913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 150160 times since January 2019
Visitors: 1518