View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_19 (Length: 294)

Name: NF0920_low_19
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_19
NF0920_low_19
[»] scaffold0061 (1 HSPs)
scaffold0061 (57-198)||(33396-33537)
[»] scaffold0017 (1 HSPs)
scaffold0017 (57-198)||(165254-165395)
[»] chr1 (3 HSPs)
chr1 (53-156)||(18287641-18287743)
chr1 (53-156)||(18292022-18292124)
chr1 (200-239)||(16404267-16404306)
[»] scaffold0001 (1 HSPs)
scaffold0001 (55-156)||(74346-74446)
[»] chr4 (6 HSPs)
chr4 (55-156)||(9249312-9249412)
chr4 (53-156)||(1641564-1641666)
chr4 (190-239)||(14655683-14655732)
chr4 (190-239)||(14674117-14674166)
chr4 (53-156)||(34270345-34270444)
chr4 (55-144)||(40465595-40465681)
[»] scaffold0401 (1 HSPs)
scaffold0401 (57-156)||(15431-15529)
[»] chr2 (6 HSPs)
chr2 (65-156)||(40793531-40793621)
chr2 (53-156)||(28270984-28271085)
chr2 (200-239)||(17258886-17258925)
chr2 (139-198)||(26267310-26267369)
chr2 (194-239)||(18084452-18084497)
chr2 (140-187)||(24043769-24043816)
[»] scaffold0225 (1 HSPs)
scaffold0225 (53-156)||(815-916)
[»] chr5 (3 HSPs)
chr5 (139-198)||(20581495-20581554)
chr5 (139-187)||(25505798-25505846)
chr5 (140-187)||(20195196-20195243)
[»] chr8 (3 HSPs)
chr8 (99-156)||(16263010-16263066)
chr8 (139-179)||(19651878-19651918)
chr8 (158-198)||(24462777-24462817)
[»] scaffold0143 (1 HSPs)
scaffold0143 (200-239)||(21464-21503)
[»] scaffold0055 (1 HSPs)
scaffold0055 (200-239)||(8750-8789)
[»] scaffold0052 (1 HSPs)
scaffold0052 (200-239)||(75746-75785)
[»] scaffold0021 (1 HSPs)
scaffold0021 (200-239)||(60041-60080)
[»] chr7 (4 HSPs)
chr7 (200-239)||(10840702-10840741)
chr7 (139-187)||(18461015-18461063)
chr7 (54-139)||(18135935-18136021)
chr7 (53-90)||(14227040-14227077)
[»] chr3 (4 HSPs)
chr3 (139-198)||(16420822-16420881)
chr3 (83-137)||(1734561-1734616)
chr3 (200-239)||(14143096-14143135)
chr3 (206-239)||(18524528-18524561)
[»] chr6 (3 HSPs)
chr6 (83-138)||(22255705-22255761)
chr6 (200-239)||(14853338-14853377)
chr6 (200-239)||(25178233-25178272)
[»] scaffold0750 (1 HSPs)
scaffold0750 (206-239)||(688-721)
[»] scaffold0260 (1 HSPs)
scaffold0260 (53-90)||(12862-12899)


Alignment Details
Target: scaffold0061 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: scaffold0061
Description:

Target: scaffold0061; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 57 - 198
Target Start/End: Complemental strand, 33537 - 33396
Alignment:
57 aagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaaca 156  Q
    ||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||    
33537 aagaagaggaaaagaagcagattcgaaccggcgaagaagataaagaaagaaaaccaatgaaacaaccgatttattttcggtcctcaagccagaatcaaca 33438  T
157 gaacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    ||||||||||||||||||||||||||||||| || |||||||    
33437 gaacaagaatcaatccaagttttcctgaagattcggttcgaa 33396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0017 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: scaffold0017
Description:

Target: scaffold0017; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 57 - 198
Target Start/End: Original strand, 165254 - 165395
Alignment:
57 aagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaaca 156  Q
    ||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||    
165254 aagaagaggaaaagaagcagattcgaaccggcgaagaagataaagaaagaaaaccaatgaaacaaccgatttattttcggtcctcaagccagaatcaaca 165353  T
157 gaacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    ||||||||||||||||||||||||||||||| || |||||||    
165354 gaacaagaatcaatccaagttttcctgaagattcggttcgaa 165395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 18287641 - 18287743
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    ||||||||||||||||||||||| ||||| ||| |||||| |||| ||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||    
18287641 tgagaagaagaggaaaagaagcagattcgaaccagcgaagaagatgaagaaagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatc 18287739  T
153 aaca 156  Q
    ||||    
18287740 aaca 18287743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 18292022 - 18292124
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    ||||||||||||||||||||||| ||||| ||| |||||| |||| ||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||    
18292022 tgagaagaagaggaaaagaagcagattcgaaccagcgaagaagatgaagaaagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatc 18292120  T
153 aaca 156  Q
    ||||    
18292121 aaca 18292124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 16404267 - 16404306
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
16404267 tctccaattgaaaccacaggtaaacacataaacttcatct 16404306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 55 - 156
Target Start/End: Complemental strand, 74446 - 74346
Alignment:
55 agaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaa 154  Q
    ||||||||||||||||||||| ||||| ||| |||||| |||| ||||||||||| ||||||||| ||||||||||||||||| ||||||||| ||||||    
74446 agaagaagaggaaaagaagcagattcgaaccagcgaagaagatgaagaaagaaaatcagtgaaataaccgatttattttcggttctcaagcca-aatcaa 74348  T
155 ca 156  Q
    ||    
74347 ca 74346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 62; Significance: 8e-27; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 55 - 156
Target Start/End: Complemental strand, 9249412 - 9249312
Alignment:
55 agaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaa 154  Q
    ||||||||||||||||||||| ||||| ||| |||||| |||| ||||||||||| ||||||||| ||||||||||||||||| ||||||||| ||||||    
9249412 agaagaagaggaaaagaagcagattcgaaccagcgaagaagatgaagaaagaaaatcagtgaaataaccgatttattttcggttctcaagcca-aatcaa 9249314  T
155 ca 156  Q
    ||    
9249313 ca 9249312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 1641564 - 1641666
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    |||||||||||| |||||||| | ||||| |||||||||| |||| |||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||    
1641564 tgagaagaagagaaaaagaagaagattcgaaccggcgaagaagatgaagagagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatc 1641662  T
153 aaca 156  Q
    ||||    
1641663 aaca 1641666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 14655683 - 14655732
Alignment:
190 cagttcgaagtctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||| ||||| ||||||||||||||||||| ||||||||||||||    
14655683 cagttcgaaatctccgattgaaaccacaggtaaacacataaacttcatct 14655732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 239
Target Start/End: Original strand, 14674117 - 14674166
Alignment:
190 cagttcgaagtctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||| ||||| ||||||||||||||||||| ||||||||||||||    
14674117 cagttcgaaatctccgattgaaaccacaggtaaacacataaacttcatct 14674166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 53 - 156
Target Start/End: Original strand, 34270345 - 34270444
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    |||||||||||| |||||||  | ||||| |||||||||| |||| ||||||||||||||  | ||| || |||||||||||||| ||||||||| ||||    
34270345 tgagaagaagagaaaaagaaa-agattcgaaccggcgaagaagatgaagaaagaaaacca--gcaataactgatttattttcggttctcaagcca-aatc 34270440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 55 - 144
Target Start/End: Complemental strand, 40465681 - 40465595
Alignment:
55 agaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaag 144  Q
    |||||||||| |||||||  | ||||| |||||||||| |||| ||||||||||||||  | ||| ||||||||||||||||| ||||||    
40465681 agaagaagagaaaaagaaa-agattcgaaccggcgaagaagatgaagaaagaaaacca--gcaataaccgatttattttcggttctcaag 40465595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0401 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0401
Description:

Target: scaffold0401; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 57 - 156
Target Start/End: Complemental strand, 15529 - 15431
Alignment:
57 aagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaaca 156  Q
    ||||||||||||||||||| ||||| |||||||||| |||| |||||||||||||| |||||  ||||||||||||||||| ||||||||| ||||||||    
15529 aagaagaggaaaagaagcagattcgaaccggcgaagaagatgaagaaagaaaaccattgaaacaaccgatttattttcggttctcaagcca-aatcaaca 15431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 7e-21; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 65 - 156
Target Start/End: Original strand, 40793531 - 40793621
Alignment:
65 gaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaaca 156  Q
    ||||||||||| ||||| || ||||||| |||| |||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||||||    
40793531 gaaaagaagcagattcgaactggcgaagaagatgaagagagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatcaaca 40793621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 53 - 156
Target Start/End: Complemental strand, 28271085 - 28270984
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    |||||||||||| |||||||  | ||||| || ||||||| |||| |||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||    
28271085 tgagaagaagagaaaaagaaa-agattcgaactggcgaagaagatgaagagagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatc 28270988  T
153 aaca 156  Q
    ||||    
28270987 aaca 28270984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 17258886 - 17258925
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
17258886 tctccaattgaaaccacaggtaaacacataaacttcatct 17258925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 26267369 - 26267310
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    |||||||||||||||||||||| ||||| ||| ||| |||||||||||| || |||||||    
26267369 ctcaagccagaatcaacagaacgagaattaattcaaattttcctgaagattcggttcgaa 26267310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 239
Target Start/End: Original strand, 18084452 - 18084497
Alignment:
194 tcgaagtctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||| |||||||||||||||||| |||||| ||||||||||||||    
18084452 tcgaaatctccaattgaaaccacaagtaaacacataaacttcatct 18084497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 187
Target Start/End: Original strand, 24043769 - 24043816
Alignment:
140 tcaagccagaatcaacagaacaagaatcaatccaagttttcctgaaga 187  Q
    ||||||||||||||||||||||||| | ||  ||||||||||||||||    
24043769 tcaagccagaatcaacagaacaagattaaactcaagttttcctgaaga 24043816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0225 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0225
Description:

Target: scaffold0225; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 53 - 156
Target Start/End: Complemental strand, 916 - 815
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatc 152  Q
    |||||||||||| |||||||  | ||||| || ||||||| |||| |||| |||||||||||||||| ||||||||||||||||| ||||||||| ||||    
916 tgagaagaagagaaaaagaaa-agattcgaactggcgaagaagatgaagagagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatc 819  T
153 aaca 156  Q
    ||||    
818 aaca 815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 20581554 - 20581495
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||| || |||||||    
20581554 ctcaagccaaaatcaacagaacaagaatcaattcaagttttcctgaagattcggttcgaa 20581495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 25505846 - 25505798
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagttttcctgaaga 187  Q
    |||||||||||||||||||||||||| ||||  ||||||||||||||||    
25505846 ctcaagccagaatcaacagaacaagattcaactcaagttttcctgaaga 25505798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 20195243 - 20195196
Alignment:
140 tcaagccagaatcaacagaacaagaatcaatccaagttttcctgaaga 187  Q
    ||||||||||||||||||||||||| | ||  ||||||||||||||||    
20195243 tcaagccagaatcaacagaacaagattaaactcaagttttcctgaaga 20195196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 99 - 156
Target Start/End: Original strand, 16263010 - 16263066
Alignment:
99 aagaaagaaaaccagtgaaatgaccgatttattttcggtcctcaagccagaatcaaca 156  Q
    ||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||    
16263010 aagaaagaaaaccagtgaaataaccgatttattttcggttctcaagcca-aatcaaca 16263066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 139 - 179
Target Start/End: Complemental strand, 19651918 - 19651878
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagtttt 179  Q
    |||||||||||||||||||||||||||||||||||||||||    
19651918 ctcaagccagaatcaacagaacaagaatcaatccaagtttt 19651878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 198
Target Start/End: Complemental strand, 24462817 - 24462777
Alignment:
158 aacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    |||||||||||||||||||||||||||||| || |||||||    
24462817 aacaagaatcaatccaagttttcctgaagattcggttcgaa 24462777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 21464 - 21503
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
21464 tctccaattgaaaccacaggtaaacacataaacttcatct 21503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0055 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0055
Description:

Target: scaffold0055; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Complemental strand, 8789 - 8750
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
8789 tctccaattgaaaccacaggtaaacacataaacttcatct 8750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0052 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0052
Description:

Target: scaffold0052; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 75746 - 75785
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
75746 tctccaattgaaaccacaggtaaacacataaacttcatct 75785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 60041 - 60080
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
60041 tctccaattgaaaccacaggtaaacacataaacttcatct 60080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 239
Target Start/End: Complemental strand, 10840741 - 10840702
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
10840741 tctccaattgaaaccacaggtaaacacataaacttcatct 10840702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 18461063 - 18461015
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagttttcctgaaga 187  Q
    |||||||||||||||||| ||||||| ||||  ||||||||||||||||    
18461063 ctcaagccagaatcaacataacaagattcaactcaagttttcctgaaga 18461015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 139
Target Start/End: Original strand, 18135935 - 18136021
Alignment:
54 gagaagaagaggaaaagaagcatattcgga-ccggcgaaggagataaagaaagaaaaccagtgaaatgaccgatttattttcggtcc 139  Q
    ||||||||||||||||||||||   | | | ||||||||| |||| |||||| | |||||||||||| |||| ||||||| ||||||    
18135935 gagaagaagaggaaaagaagcaaggttgaaaccggcgaagaagatgaagaaacagaaccagtgaaatcaccggtttatttccggtcc 18136021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 90
Target Start/End: Complemental strand, 14227077 - 14227040
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcga 90  Q
    ||||||||||||||||||||||| ||||| ||||||||    
14227077 tgagaagaagaggaaaagaagcagattcgaaccggcga 14227040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 16420881 - 16420822
Alignment:
139 ctcaagccagaatcaacagaacaagaatcaatccaagttttcctgaagactcagttcgaa 198  Q
    |||||||||||||||||||||||||| ||||  ||||||||| |||||| || |||||||    
16420881 ctcaagccagaatcaacagaacaagattcaactcaagttttcttgaagattcggttcgaa 16420822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 83 - 137
Target Start/End: Complemental strand, 1734616 - 1734561
Alignment:
83 accggcgaaggagataaagaaagaaaaccagt-gaaatgaccgatttattttcggt 137  Q
    |||||||||| |||||||||||| |||||||| ||||  |||||||||||||||||    
1734616 accggcgaagaagataaagaaagcaaaccagtggaaaacaccgatttattttcggt 1734561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 239
Target Start/End: Complemental strand, 14143135 - 14143096
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||| ||||||||||||||||| ||||||||||||||    
14143135 tctccaactgaaaccacaggtaaacacataaacttcatct 14143096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 239
Target Start/End: Original strand, 18524528 - 18524561
Alignment:
206 attgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||| ||||||||||||||    
18524528 attgaaaccacaggtaaacacataaacttcatct 18524561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 83 - 138
Target Start/End: Complemental strand, 22255761 - 22255705
Alignment:
83 accggcgaaggagataaagaaagaaaaccagt-gaaatgaccgatttattttcggtc 138  Q
    |||||||||| |||||||||||| |||||||| ||||  ||||||||||||||||||    
22255761 accggcgaagaagataaagaaagcaaaccagtggaaaacaccgatttattttcggtc 22255705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 14853338 - 14853377
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||| ||||||||||||||||| ||||||||||||||    
14853338 tctccaaatgaaaccacaggtaaacacataaacttcatct 14853377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 25178233 - 25178272
Alignment:
200 tctccaattgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||| ||||||||||||||||| ||||||||||||||    
25178233 tctccaactgaaaccacaggtaaacacataaacttcatct 25178272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0750 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0750
Description:

Target: scaffold0750; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 239
Target Start/End: Complemental strand, 721 - 688
Alignment:
206 attgaaaccacaggtaaacgcataaacttcatct 239  Q
    ||||||||||||||||||| ||||||||||||||    
721 attgaaaccacaggtaaacacataaacttcatct 688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 90
Target Start/End: Complemental strand, 12899 - 12862
Alignment:
53 tgagaagaagaggaaaagaagcatattcggaccggcga 90  Q
    ||||||||||||||||||||||| ||||| ||||||||    
12899 tgagaagaagaggaaaagaagcagattcgaaccggcga 12862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137236 times since January 2019
Visitors: 1446