View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_2 (Length: 601)

Name: NF0920_low_2
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_2
NF0920_low_2
[»] chr5 (5 HSPs)
chr5 (96-573)||(6399479-6399956)
chr5 (96-573)||(6412546-6413023)
chr5 (96-580)||(6409803-6410284)
chr5 (174-413)||(6405258-6405494)
chr5 (480-543)||(6403009-6403072)
[»] chr4 (1 HSPs)
chr4 (4-79)||(48912660-48912735)


Alignment Details
Target: chr5 (Bit Score: 446; Significance: 0; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 96 - 573
Target Start/End: Complemental strand, 6399956 - 6399479
Alignment:
96 aaagcttcatggtagcttttcagccaagccaacatctccgcgaaaaaatatagccgaacagaacagcttcaagtcaagacaaacatcgaacgctgaaatg 195  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||  ||| | |||||||| |||||||||    
6399956 aaagcttcatggtagcttttcagccaagccaatatctccgcgaaaaaatatagccgaacagaacagcttcaagttgagagagacatcgaatgctgaaatg 6399857  T
196 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacacaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6399856 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacaaaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 6399757  T
296 aagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggcttcatagactttaaagagtttat 395  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6399756 aagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggcttcatagactttaaagagtttat 6399657  T
396 ggaaatgttcaatggagagggtagtaagataaaagaagaagatattaagagtgcttttcaagtatttgatataaatggtgatgggaaaattagtgctgag 495  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6399656 ggaaatgttcaatggagaaggtagtaagataaaagaagaagatattaagagtgcttttcaagtatttgatataaatggtgatgggaaaattagtgctgag 6399557  T
496 gaattgtctcaaatatttaagaggttaggagagagttgtagccttagtgcttgtaagaaaatggtgaaaggggttgat 573  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6399556 gaattgtctcaaatatttaagaggttaggagagagttgtagccttagtgcttgtaagaaaatggtgaaaggggttgat 6399479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 96 - 573
Target Start/End: Original strand, 6412546 - 6413023
Alignment:
96 aaagcttcatggtagcttttcagccaagccaacatctccgcgaaaaaatatagccgaacagaacagcttcaagtcaagacaaacatcgaacgctgaaatg 195  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||  ||| | |||||||| |||||||||    
6412546 aaagcttcatggtagcttttcagccaagccaatatctccgcgaaaaaatatagccgaacagaacagcttcaagttgagagagacatcgaatgctgaaatg 6412645  T
196 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacacaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
6412646 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacaaaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 6412745  T
296 aagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggcttcatagactttaaagagtttat 395  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6412746 aagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggcttcatagactttaaagagtttat 6412845  T
396 ggaaatgttcaatggagagggtagtaagataaaagaagaagatattaagagtgcttttcaagtatttgatataaatggtgatgggaaaattagtgctgag 495  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6412846 ggaaatgttcaatggagaaggtagtaagataaaagaagaagatattaagagtgcttttcaagtatttgatataaatggtgatgggaaaattagtgctgag 6412945  T
496 gaattgtctcaaatatttaagaggttaggagagagttgtagccttagtgcttgtaagaaaatggtgaaaggggttgat 573  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6412946 gaattgtctcaaatatttaagaggttaggagagagttgtagccttagtgcttgtaagaaaatggtgaaaggggttgat 6413023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 96 - 580
Target Start/End: Original strand, 6409803 - 6410284
Alignment:
96 aaagcttcatggtagcttttcagccaagccaacatctccgcgaaaaaatatagccgaacagaacagcttcaagtcaagacaaacatcgaacgctgaaatg 195  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||  || |||||||||||||||  ||| | |||||||   | ||||||    
6409803 aaagtttcatggtagcttttcagccaagccaacatctccgcgaaaaaatatagctcaaaagaacagcttcaagttgagagagacatcgagtaccgaaatg 6409902  T
196 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacacaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
6409903 agtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaatttgacacaaacaaagatggcaagattagtctggaagagtataaagcagctgcaa 6410002  T
296 aagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggcttcatagactttaaagagtttat 395  Q
    || |||||||||||||||||    | ||   ||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||||||||||| ||    
6410003 aatctttggataaggggattg---gggatcctgatgcagtgaaagcatttaacgtgatggactctgacaaagatggcttcatagactttaaagagttcat 6410099  T
396 ggaaatgttcaatggagagggtagtaagataaaagaagaagatattaagagtgcttttcaagtatttgatataaatggtgatgggaaaattagtgctgag 495  Q
    ||||||||||||||||||    | ||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||    
6410100 ggaaatgttcaatggagaaaacaataagataaaagaagaggagattaagagtgcttttcaagtatttgatataaatggagatgggaaaatcagtgctgag 6410199  T
496 gaattgtctcaaatatttaagaggttaggagagagttgtagccttagtgcttgtaagaaaatggtgaaaggggttgatgatgatg 580  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| |||||    
6410200 gaattgtctcaaatatttaagaggttaggagagagttgcagccttagtgcttgtaagaaaatggtgaaaggtgtcgatggtgatg 6410284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 174 - 413
Target Start/End: Complemental strand, 6405494 - 6405258
Alignment:
174 acaaacatcgaacgctgaaatgagtttccaaccaaagaaagatgaaatgaaatgggtgtttgagaaattcgacacaaacaaagatggcaagattagtctg 273  Q
    |||||||| ||| || ||| |||||||||||| ||||||||||||||||||| |||| || ||||||||||||||||||||||||||||| |||||| ||    
6405494 acaaacattgaatgccgaactgagtttccaacaaaagaaagatgaaatgaaacgggttttcgagaaattcgacacaaacaaagatggcaatattagtttg 6405395  T
274 gaagagtataaagcagctgcaaaagctttggataaggggattatttgtgacaatgatgcagtgaaagcatttaaagcaatggactctgacaaagatggct 373  Q
    |||||||||||||||||||||||||||||||||||||||    |  | || | ||||||||||||||||||||| || ||||||| |||||||||||| |    
6405394 gaagagtataaagcagctgcaaaagctttggataagggg---gtaggggatactgatgcagtgaaagcatttaaggccatggactatgacaaagatggat 6405298  T
374 tcatagactttaaagagtttatggaaatgttcaatggaga 413  Q
    |||||||||||| |||||||||||||||||||||||||||    
6405297 tcatagactttagagagtttatggaaatgttcaatggaga 6405258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 480 - 543
Target Start/End: Complemental strand, 6403072 - 6403009
Alignment:
480 gaaaattagtgctgaggaattgtctcaaatatttaagaggttaggagagagttgtagccttagt 543  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
6403072 gaaaattagtgctgatgaattgtctcaaatatttaagaggttaggagagagttgtagccttagt 6403009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 48912735 - 48912660
Alignment:
4 tgcatgtttagctttttcaccaaacgctcgagggtgttgtctgattttatcagattcatcaacacagtacatcaat 79  Q
    ||||||||||||||| || |||||| ||||||  |||||||||||||| |||| ||||||| ||| || |||||||    
48912735 tgcatgtttagctttctccccaaactctcgagcatgttgtctgattttctcagcttcatcaccactgtccatcaat 48912660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149248 times since January 2019
Visitors: 1516