View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_20 (Length: 289)

Name: NF0920_low_20
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_20
NF0920_low_20
[»] chr8 (3 HSPs)
chr8 (29-174)||(45181700-45181845)
chr8 (65-252)||(45174745-45174927)
chr8 (205-274)||(45181633-45181702)
[»] chr6 (1 HSPs)
chr6 (191-248)||(29961966-29962023)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 29 - 174
Target Start/End: Complemental strand, 45181845 - 45181700
Alignment:
29 agtactctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacctacaaattataatcag 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
45181845 agtactctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacgtacaaattataatcag 45181746  T
129 taattacctctatcaacgtatgcttacttaatttacctacttttac 174  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||    
45181745 taattacctctatcaacgtatgcttacttgatttacctacttttac 45181700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 65 - 252
Target Start/End: Complemental strand, 45174927 - 45174745
Alignment:
65 tttcattaaacaattatgttttgcctttt-aagattttcagatggaacctacaaattataatcagtaattacctctatcaac-gtatgcttacttaattt 162  Q
    |||||| || |||||||||||| |||||| ||||||||||| |||||||||||||||  ||||  ||  ||||||| | ||| |  |||| |||||||||    
45174927 tttcatcaatcaattatgtttttcctttttaagattttcagttggaacctacaaattgcaatc--tagctacctctctaaaccgcttgctgacttaattt 45174830  T
163 acctacttttacaaaggactatattatattgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaagtttt 252  Q
    |||||||||||| ||||||||| ||     ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
45174829 acctacttttaccaaggactatgtt-----gcaactaggtggtaccgtgcacctgaactatgtggttcttttttctcaaaagtaagtttt 45174745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 205 - 274
Target Start/End: Complemental strand, 45181702 - 45181633
Alignment:
205 taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatatattctt 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
45181702 taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatattttctt 45181633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 29962023 - 29961966
Alignment:
191 ttgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaag 248  Q
    |||| ||| ||||||| |||||||||||||||||||||||||||||| ||||||||||    
29962023 ttgcgactcggtggtatcgtgcacctgaactatgtggttcttttttctcaaaagtaag 29961966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150178 times since January 2019
Visitors: 1518