View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_22 (Length: 282)

Name: NF0920_low_22
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_22
NF0920_low_22
[»] chr4 (1 HSPs)
chr4 (1-279)||(4075284-4075562)
[»] chr7 (1 HSPs)
chr7 (5-201)||(25824676-25824872)


Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 4075284 - 4075562
Alignment:
1 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
4075284 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttagaggctcccattgcttcctatagatagatggatgaccttct 4075383  T
101 tttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccacttgcatcattttag 200  Q
    |||||||||||||| || ||||| |||||||||||||||||||||||||||||  |||||||||||| |||||||||||| |||||||||||||||||||    
4075384 tttctgtactctgagagttgtgttatgttaagcaattgaacattcaaacctcttcttttcaaatcttgtagaacattttccaccacttgcatcattttag 4075483  T
201 gaacagaaccatttccactatatccatcttctgtaatttgatctctttctttgtaacaattttcaccctttgcttctcc 279  Q
    ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
4075484 gaacagaaccatttccactatatccctcttctttaatttgatctctttctttgtaacaattttcaccctttgctcctcc 4075562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 25824872 - 25824676
Alignment:
5 caccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttcttttc 104  Q
    ||||||||||||||||||||||||   |||||||||||||| || ||||  |||| ||| ||||| || |||||||||||||| || || ||||||||||    
25824872 caccaatgtatgcaatctgcataaccatttggatttgatatctgttcttgagttagaggttcccactgtttcctatagatagaagggtgaccttcttttc 25824773  T
105 tgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccacttgcatcattttagg 201  Q
    |||| ||||| || |||||||||||||||| ||||||||| |||||| | ||||||||||| || || || || || ||||||||||||||||||||    
25824772 tgtattctgagagttgtgtgatgttaagcatttgaacatttaaaccttttgttttcaaatcatcaagcaccttctccaccacttgcatcattttagg 25824676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142327 times since January 2019
Visitors: 1480