View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_23 (Length: 279)

Name: NF0920_low_23
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_23
NF0920_low_23
[»] chr6 (3 HSPs)
chr6 (1-181)||(14534374-14534554)
chr6 (1-181)||(14530025-14530205)
chr6 (111-173)||(14516932-14516994)
[»] chr3 (3 HSPs)
chr3 (6-181)||(37339917-37340092)
chr3 (78-181)||(37328762-37328864)
chr3 (79-157)||(23347142-23347220)
[»] scaffold0022 (1 HSPs)
scaffold0022 (125-157)||(163472-163504)


Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 14534554 - 14534374
Alignment:
1 ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
14534554 ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatctgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt 14534455  T
101 gccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc 181  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14534454 gccatttcaaacctttttacggtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc 14534374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 14530205 - 14530025
Alignment:
1 ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||    
14530205 ttatttttgtaatttaacccacaatactttgaaaaaacttatgaatctgcacgccttggcgagagaattctgcatatcttatctatgattgtttttattt 14530106  T
101 gccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc 181  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14530105 gccatttcaaacctctttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc 14530025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 111 - 173
Target Start/End: Complemental strand, 14516994 - 14516932
Alignment:
111 acctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaat 173  Q
    |||| ||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||    
14516994 acctctttactgtcttttatcaggccatgggtggtaattgaaaaacaagtaggtctcaaaaat 14516932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 6 - 181
Target Start/End: Original strand, 37339917 - 37340092
Alignment:
6 tttgtaatttaacccacaatactttgaaaaaacttatgaatccgcacggcttggcgagagaattctgcatatcttatctatgattgtttttatttgccat 105  Q
    ||||||||||||||||||| ||||  ||||   || || ||| ||| | || ||||||| ||||||| |||| ||||||||||||||||| |||||||||    
37339917 tttgtaatttaacccacaacacttacaaaattattttggatctgcaagcctaggcgagataattctgtatatgttatctatgattgttttcatttgccat 37340016  T
106 ttcaaacctttttaccgtctttt-ttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtcaaagc 181  Q
    || |||||| || || ||||||| |||||||||||||||||||||||||||||||| || ||||||||| |||||||    
37340017 tt-aaacctcttcactgtctttttttcaggccatgggtggtaattgaaaaacaagtaggcctcaaaaatatcaaagc 37340092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 78 - 181
Target Start/End: Original strand, 37328762 - 37328864
Alignment:
78 cttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtca 177  Q
    ||||| ||| |||||| | ||||||||||  |||||| || || || ||||||||||||||||||| ||||||||||||||||||||||||||||| |||    
37328762 cttatgtattattgttatcatttgccattg-aaacctcttcactgtattttttcaggccatgggtgataattgaaaaacaagtgggtctcaaaaatatca 37328860  T
178 aagc 181  Q
    ||||    
37328861 aagc 37328864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 157
Target Start/End: Original strand, 23347142 - 23347220
Alignment:
79 ttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaaca 157  Q
    |||||||||||||| || ||||  ||||| |||||| ||||| |||| |||||| |||||||||| |||||||||||||    
23347142 ttatctatgattgtattgattttgcatttgaaacctctttactgtctcttttcaagccatgggtgttaattgaaaaaca 23347220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 157
Target Start/End: Complemental strand, 163504 - 163472
Alignment:
125 ttttttcaggccatgggtggtaattgaaaaaca 157  Q
    |||||||| ||||||||||||||||||||||||    
163504 ttttttcaagccatgggtggtaattgaaaaaca 163472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142245 times since January 2019
Visitors: 1479