View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_24 (Length: 271)

Name: NF0920_low_24
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_24
[»] chr2 (13 HSPs)
chr2 (45-271)||(9030084-9030311)
chr2 (126-232)||(9026536-9026643)
chr2 (126-232)||(9031803-9031910)
chr2 (126-268)||(8991916-8992058)
chr2 (108-232)||(9016222-9016345)
chr2 (150-232)||(8975455-8975536)
chr2 (126-232)||(9023171-9023276)
chr2 (126-206)||(8988193-8988272)
chr2 (126-232)||(9020606-9020710)
chr2 (126-222)||(8973079-8973176)
chr2 (47-103)||(9016146-9016203)
chr2 (159-232)||(8996134-8996206)
chr2 (58-123)||(9020153-9020216)
[»] chr1 (1 HSPs)
chr1 (126-232)||(33987813-33987918)

Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 13)
Name: chr2

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 45 - 271
Target Start/End: Original strand, 9030084 - 9030311
45 tcagatcttgagttattattgtttatttcattccgtatgtttctt-atttatgcttagaagaactagtataaattatccaacaagaatcagatcgtgata 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030084 tcagatcttgagttattattgtttatttcattccgtatgtttctttatttatgcttagaagaactagtataaattatccaacaagaatcagatcgtgata 9030183  T
144 tttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataatagaggaagaaa 243  Q
    ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030184 tttggctttaagacaagaatatcaatttaattttttgacaattcatcatgatggcctatgtgtgtctatttactctgattgatgataatagaggaagaaa 9030283  T
244 gtgttaggaagagtctaccaagcaagct 271  Q
9030284 gtgttaggaagagtctaccaagcaagct 9030311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9026536 - 9026643
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtcta--tttactctgatt 223  Q
    |||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||  ||||||||||||    
9026536 aagaataagatcatgatattttgctttaagacaagaatatcaatttaa-tttttggcaattcatcacgatggcctatgtgtgtgtatttttactctgatt 9026634  T
224 gatgataat 232  Q
9026635 gatgataat 9026643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9031803 - 9031910
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtcta--tttactctgatt 223  Q
    |||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||  ||||||||||||    
9031803 aagaataagatcatgatattttgctttaagacaagaatatcaatttaa-tttttggcaattcatcacgatggcctatgtgtgtgtatttttactctgatt 9031901  T
224 gatgataat 232  Q
9031902 gatgataat 9031910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 126 - 268
Target Start/End: Original strand, 8991916 - 8992058
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttgg-caagtcatcatgatggcctatgtgtgtctatttactctgattg 224  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||    ||| |||| |||||||||||||||| | |||||||||||||      
8991916 aagaatcagatcatgatattttgctttaagacaagaatatcaatttaatttttgcttcaattcataatgatggcctatgtgtatgtatttactctgat-- 8992013  T
225 atgataatagaggaagaaagtgttagga--agagtctaccaagcaa 268  Q
      |||||  ||| |||| ||||||||||  ||||||||||||||||    
8992014 -cgataaaggagaaagagagtgttaggaagagagtctaccaagcaa 8992058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 108 - 232
Target Start/End: Original strand, 9016222 - 9016345
108 tagtataaattatccaacaagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtg 207  Q
    ||||||||||||| ||| |||| ||||||| |||||||| ||| ||||||||||||||||||||||||||||  ||| |||| ||  ||||| ||||||     
9016222 tagtataaattattcaataagagtcagatcatgatattttgctataagacaagaatatcaatttaatttttt-tcaattcataatcgtggcccatgtgta 9016320  T
208 tctatttactctgattgatgataat 232  Q
    | |||||||||| ||||||||||||    
9016321 tgtatttactctaattgatgataat 9016345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 150 - 232
Target Start/End: Original strand, 8975455 - 8975536
150 tttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataat 232  Q
    |||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||| | |||||||||||||||||||||||    
8975455 tttaagactagaatatcaatttaattgtt-ggcaattcatcatgatggcctatgtgtatgtatttactctgattgatgataat 8975536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9023171 - 9023276
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    |||||||||||| ||||| || |||||||| ||||||||||||||||| |||||||||| ||||| |||||||||| |||| | |||||||| |||||||    
9023171 aagaatcagatcatgatactttgctttaagtcaagaatatcaatttaa-tttttggcaattcatcgtgatggcctaggtgtatgtatttactatgattga 9023269  T
226 tgataat 232  Q
    | |||||    
9023270 tcataat 9023276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 126 - 206
Target Start/End: Original strand, 8988193 - 8988272
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgt 206  Q
    |||||||||||| |||||||| || ||||||||||||||||||||| | |||||||||| |||||||||||||||||||||    
8988193 aagaatcagatcatgatattttgccttaagacaagaatatcaatttta-tttttggcaattcatcatgatggcctatgtgt 8988272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9020606 - 9020710
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    ||||||| |||| |||||||| |||||||||| ||||||||||||||| |||||||||| ||| |||| ||||| |||||| | ||| |||| |||||||    
9020606 aagaatccgatcatgatattttgctttaagacgagaatatcaatttaa-tttttggcaattcaccatg-tggccaatgtgtatgtatctactttgattga 9020703  T
226 tgataat 232  Q
9020704 tgataat 9020710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 222
Target Start/End: Original strand, 8973079 - 8973176
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttt-tggcaagtcatcatgatggcctatgtgtgtctatttactctgat 222  Q
    |||||||||||| |||||||| |||| ||||||||||||||||||||||||||    ||| |||| ||| ||||||||||||   |||||||||||||    
8973079 aagaatcagatcatgatattttgcttcaagacaagaatatcaatttaatttttgcttcaattcataatggtggcctatgtgtaagtatttactctgat 8973176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 103
Target Start/End: Original strand, 9016146 - 9016203
47 agatcttgagttattattgtttatttcattccgtatgtttc-ttatttatgcttagaa 103  Q
    |||||||||||||||  ||||||||||||||| |||||||| ||||||||||||||||    
9016146 agatcttgagttattggtgtttatttcattccatatgtttctttatttatgcttagaa 9016203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 232
Target Start/End: Original strand, 8996134 - 8996206
159 agaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataat 232  Q
    ||||||| |||||||||||| ||||| ||| ||||||||||||||| | | ||| |||| ||||||||||||||    
8996134 agaatattaatttaattttt-ggcaattcaccatgatggcctatgtttatgtatctactatgattgatgataat 8996206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 123
Target Start/End: Original strand, 9020153 - 9020216
58 tattattgtttatttcattccgtatgtttctt-atttatgcttagaagaactagtataaattatcca 123  Q
    |||| |||||| ||||||||| |||||||||| ||||||||||   |||||||||||||| ||||||    
9020153 tattgttgtttctttcattccttatgtttcttaatttatgctt---agaactagtataaactatcca 9020216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 33987813 - 33987918
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    |||||||||||| |||||||| ||| |||||||||||||| |||||||||||| ||||| |||||||||||| |||||||| | ||| ||||||||||||    
33987813 aagaatcagatcatgatattttgctgtaagacaagaatattaatttaattttt-ggcaattcatcatgatggactatgtgtatgtatctactctgattga 33987911  T
226 tgataat 232  Q
33987912 tgataat 33987918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142163 times since January 2019
Visitors: 1479