View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_25 (Length: 254)

Name: NF0920_low_25
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_25
[»] chr3 (2 HSPs)
chr3 (12-239)||(11394042-11394269)
chr3 (12-239)||(46233766-46233993)
[»] chr2 (1 HSPs)
chr2 (12-239)||(9208594-9208821)
[»] chr1 (1 HSPs)
chr1 (12-239)||(32440452-32440679)
[»] chr7 (1 HSPs)
chr7 (12-239)||(16262485-16262712)
[»] chr5 (2 HSPs)
chr5 (12-66)||(21592442-21592496)
chr5 (12-66)||(21596559-21596613)

Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 11394269 - 11394042
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
11394269 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaaacattggaattaacaa 11394170  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11394169 tgcaaacattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 11394070  T
212 gggttttggagtgataattggagtgtta 239  Q
11394069 gggttttggagtgataattggagtgtta 11394042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 46233766 - 46233993
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
46233766 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 46233865  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46233866 tgcaaacattggaactatgcacgcgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 46233965  T
212 gggttttggagtgataattggagtgtta 239  Q
46233966 gggttttggagtgataattggagtgtta 46233993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 9208821 - 9208594
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
9208821 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 9208722  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9208721 tgcaaacattggaactatgcacgcgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 9208622  T
212 gggttttggagtgataattggagtgtta 239  Q
9208621 gggttttggagtgataattggagtgtta 9208594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 32440452 - 32440679
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
32440452 agagagggaggagagaaagcgacgatgaagagggtgggtcggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 32440551  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32440552 tgcaaacattgaaactatgcacacgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 32440651  T
212 gggttttggagtgataattggagtgtta 239  Q
32440652 gggttttggagtgataattggagtgtta 32440679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 16262485 - 16262712
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
16262485 agagagggaggagagaaagcaacaatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 16262584  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||| ||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
16262585 tgcaaacattgaaacaatgcacgcgtttcacaaagtttgatataaacggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 16262684  T
212 gggttttggagtgataattggagtgtta 239  Q
    |||||||||||||||||||| |||||||    
16262685 gggttttggagtgataattgaagtgtta 16262712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 21592496 - 21592442
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgtt 66  Q
    |||||||||| ||||| ||||| ||||| ||| ||||||| ||||||||||||||    
21592496 agagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgtt 21592442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 21596613 - 21596559
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgtt 66  Q
    |||||||||| ||||| ||||| ||||| ||| ||||||| ||||||||||||||    
21596613 agagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgtt 21596559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149103 times since January 2019
Visitors: 1516