View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_26 (Length: 251)

Name: NF0920_low_26
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_26
[»] chr6 (1 HSPs)
chr6 (11-251)||(3345972-3346212)

Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 3346212 - 3345972
11 acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgcaaagtttatccaaatgatattttac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||    
3346212 acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgctaagtttatccaaatgctattttac 3346113  T
111 acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg 210  Q
3346112 acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg 3346013  T
211 tttcattaataacaacagtcaaaatataagatgacaattga 251  Q
3346012 tttcattaataacaacagtcaaaatataagatgacaattga 3345972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 141892 times since January 2019
Visitors: 1478