View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_27 (Length: 251)

Name: NF0920_low_27
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_27
[»] chr2 (6 HSPs)
chr2 (2-236)||(9030643-9030877)
chr2 (1-237)||(9012964-9013199)
chr2 (1-237)||(9021106-9021337)
chr2 (126-237)||(13046162-13046273)
chr2 (116-213)||(8996946-8997045)
chr2 (124-156)||(8988726-8988758)

Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 6)
Name: chr2

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 236
Target Start/End: Original strand, 9030643 - 9030877
2 ttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaac 101  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030643 ttactctggacatatatcaaatatatatcaaaatccaaggtgtggatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaac 9030742  T
102 aacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacag 201  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030743 aacatagagtgtatgttcttgcacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacag 9030842  T
202 ttgtgtttttgggtgtgctcctgatgatgtccatc 236  Q
    |||||||||||||||||||||| ||||| ||||||    
9030843 ttgtgtttttgggtgtgctcctaatgatatccatc 9030877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 9012964 - 9013199
1 tttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaa 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |||||||    
9012964 tttactctgggcatatatcaaatatatatcaaaatgcaaggtgtggatagaagttctattttt-cttccctcaatttgtaattgattaaaacaaatagaa 9013062  T
101 caacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
9013063 caacaaagagtgtatgttcttgcacaaagagatattagtatctcacaaaacaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 9013162  T
201 gttgtgtttttgggtgtgctcctgatgatgtccatct 237  Q
     |||||||||||| ||||||||| ||||| |||||||    
9013163 cttgtgtttttggatgtgctcctaatgatatccatct 9013199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 9021106 - 9021337
1 tttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaa 100  Q
    |||| ||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    ||||| |||||||    
9021106 tttaatctgggcatatataaaatatatatcaaaatgcatggtgttgatagaagttctattttt-cttctctcaatttgtaatt----aaaacaaatagaa 9021200  T
101 caacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 200  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||    
9021201 caacaaagagtgtatgttcttgcacaaagagatattagaatctcacaaagcaaaggttcaacttctggtattccacattacattgtgcaaattgttagca 9021300  T
201 gttgtgtttttgggtgtgctcctgatgatgtccatct 237  Q
     |||||||||||| | | ||||| ||||| |||||||    
9021301 cttgtgtttttggatattctcctcatgatatccatct 9021337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 126 - 237
Target Start/End: Complemental strand, 13046273 - 13046162
126 aaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacagttgtgtttttgggtgtgctcctga 225  Q
    ||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||| |||||||| ||| ||||||||| |    
13046273 aaagagacattagtatctcacaaagcaaaggttcaacttctggaattccacagtacattgtgcaaattgttaacacttgtgtttctggatgtgctcctta 13046174  T
226 tgatgtccatct 237  Q
    |||| |||||||    
13046173 tgatatccatct 13046162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 116 - 213
Target Start/End: Original strand, 8996946 - 8997045
116 gttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatac--attatgcaaattgttaacagttgtgtttttgg 213  Q
    ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||| ||||||||||| ||| ||||||||    
8996946 gttcttgcacgaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacatattgtgccaattgttaacacttgcgtttttgg 8997045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 156
Target Start/End: Original strand, 8988726 - 8988758
124 acaaagagatattagtatctcacaaagcaaagg 156  Q
    |||||||||||||||||||||||||||| ||||    
8988726 acaaagagatattagtatctcacaaagcgaagg 8988758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 141806 times since January 2019
Visitors: 1478