View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_28 (Length: 234)

Name: NF0920_low_28
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_28
[»] chr4 (2 HSPs)
chr4 (17-143)||(26171554-26171676)
chr4 (135-234)||(26171141-26171240)
[»] chr7 (1 HSPs)
chr7 (14-217)||(42448314-42448510)
[»] chr1 (2 HSPs)
chr1 (14-151)||(6612997-6613130)
chr1 (202-234)||(6613142-6613174)
[»] chr2 (1 HSPs)
chr2 (91-150)||(21733334-21733393)
[»] chr3 (1 HSPs)
chr3 (91-150)||(3671832-3671891)
[»] chr6 (3 HSPs)
chr6 (121-218)||(26064369-26064459)
chr6 (121-218)||(26084338-26084428)
chr6 (154-216)||(25516101-25516164)

Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 143
Target Start/End: Complemental strand, 26171676 - 26171554
17 taaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaacaaattgtttctctatgtattgggttcatggcatgataacttggtg 116  Q
    |||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
26171676 taaatatgaattccagaaatgtcttaagctgcata----acttcgaaacaggaacaaattgttgctctatgtattgggttcatggcatgataacttggtg 26171581  T
117 ttgaaagagattactgcataaagtgaa 143  Q
26171580 ttgaaagagattactgcataaagtgaa 26171554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 135 - 234
Target Start/End: Complemental strand, 26171240 - 26171141
135 taaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttctttatatcattaaggtt 234  Q
26171240 taaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttctttatatcattaaggtt 26171141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 42448510 - 42448314
14 taataaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaa-caaattgtttctctatgtattgggttcatggcatgataactt 112  Q
    ||||||||| ||| ||||| ||||| ||||||||||||    ||||| ||||||||| ||  ||||| ||||| |||||| ||||||||||||| |||||    
42448510 taataaataagaaatccagtaatgtgttaagctgcata----acttccaaacaggaagcactttgttgctctaagtattgtgttcatggcatgacaactt 42448415  T
113 ggtgttgaaagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttga 212  Q
    |||||||||||||||| ||||| |  |||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||| |||||||||||    
42448414 ggtgttgaaagagattgctgcaga--gtgaatatagtagcagagcttgtggttctaa--atgtgtttttatctctttatatcaaattggtgcaattttga 42448319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 14 - 151
Target Start/End: Original strand, 6612997 - 6613130
14 taataaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaacaaattgtttctctatgtattgggttcatggcatgataacttg 113  Q
    ||||||||||||||||||| ||||| ||||||||||||    ||||| |||||| | || | |||| ||||||||||||||||||||||| || ||||||    
6612997 taataaatatgaattccaggaatgtgttaagctgcata----acttccaaacagaagcacaatgttgctctatgtattgggttcatggcacgacaacttg 6613092  T
114 gtgttgaaagagattactgcataaagtgaatatagtag 151  Q
    |||||||||||||| |||||||||||||||||||||||    
6613093 gtgttgaaagagatcactgcataaagtgaatatagtag 6613130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 234
Target Start/End: Original strand, 6613142 - 6613174
202 tgcaattttgactttctttatatcattaaggtt 234  Q
    |||||||||||||||||||||||||| ||||||    
6613142 tgcaattttgactttctttatatcatcaaggtt 6613174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 21733334 - 21733393
91 tgggttcatggcatgataacttggtgttgaaagagattactgcataaagtgaatatagta 150  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
21733334 tgggttcatggcatgataacttggtgttgaaaaagattactgcataaagtgaatatagta 21733393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 91 - 150
Target Start/End: Complemental strand, 3671891 - 3671832
91 tgggttcatggcatgataacttggtgttgaaagagattactgcataaagtgaatatagta 150  Q
    ||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||    
3671891 tgggttcttggcatgacaacttggtgttgaaagatattactgcataaagtgaatatagta 3671832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr6

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 26064369 - 26064459
121 aagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttct 218  Q
    ||||| ||| |||| ||||||||||||||     ||||||||||||||||| |||   |||| ||||||||||||||||| ||||||||| |||||||    
26064369 aagaggttaatgcagaaagtgaatatagtt----agtttgtggttctaattgtgt---tttacctctttatatcaaattggtgcaatttttactttct 26064459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 26084338 - 26084428
121 aagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttct 218  Q
    ||||| ||| |||| ||||||||||||||     ||||||||||||||||| |||   |||| ||||||||||||||||| ||||||||| |||||||    
26084338 aagaggttaatgcagaaagtgaatatagtt----agtttgtggttctaattgtgt---tttacctctttatatcaaattggtgcaatttttactttct 26084428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 216
Target Start/End: Original strand, 25516101 - 25516164
154 gagtttgtggttctaattatgtgttttt-atctctttatatcaaattgctgcaattttgacttt 216  Q
    |||||||||||||||| | ||| ||||| ||| ||||||||||||||| ||||||||| |||||    
25516101 gagtttgtggttctaaatgtgttttttttatcgctttatatcaaattggtgcaatttttacttt 25516164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142462 times since January 2019
Visitors: 1480