View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_29 (Length: 232)

Name: NF0920_low_29
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_29
NF0920_low_29
[»] chr7 (1 HSPs)
chr7 (1-232)||(25015084-25015315)
[»] chr8 (1 HSPs)
chr8 (56-232)||(12662793-12662971)
[»] chr4 (1 HSPs)
chr4 (161-227)||(5129633-5129699)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 25015315 - 25015084
Alignment:
1 ctgattgttacttcaaatattgcagacaaattgacttcttcactggtcctacaggtatataaaattgttcattattcattaattaatgtaaattttgatc 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
25015315 ctgattgttacttcaaatattgcagacaaattgccttcttcactggtcctacaggtatataaaattgttcattattccttaattaatgtaaattttgatc 25015216  T
101 taaattgaatataattgattatgtggaactaaaatttacgtattctctattattacagttggaggacttcttaatgcaacatgtgggaatattaccgagc 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25015215 taaattgaatataattgattatgtggaactaaaatttatgtattctctattattacagttggaggacttcttaatgcaacatgtgggaatattactgagc 25015116  T
201 tgatcatagcaatatttgctcttagcagcaac 232  Q
    ||||||||||||||||||||||||||||||||    
25015115 tgatcatagcaatatttgctcttagcagcaac 25015084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 56 - 232
Target Start/End: Complemental strand, 12662971 - 12662793
Alignment:
56 tatataaaattgttcattattcattaattaatgta-aattttgatctaaattgaatataattgattatgtggaactaaaa-tttacgtattctctattat 153  Q
    ||||||||||||||||| | ||||| ||||||||  |||||||| ||||  | |||||||||||||||||| | |||||  |||| | ||||||||||||    
12662971 tatataaaattgttcataactcattgattaatgtttaattttgaactaagctaaatataattgattatgtgaagctaaatgtttatgcattctctattat 12662872  T
154 tacagttggaggacttcttaatgcaacatgtgggaatattaccgagctgatcatagcaatatttgctcttagcagcaac 232  Q
    |||||||||||| |||||||||||||||| |||||||||||| ||| ||||  ||||||||||||||||||||||||||    
12662871 tacagttggagggcttcttaatgcaacatttgggaatattactgagttgatagtagcaatatttgctcttagcagcaac 12662793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 5129633 - 5129699
Alignment:
161 ggaggacttcttaatgcaacatgtgggaatattaccgagctgatcatagcaatatttgctcttagca 227  Q
    ||||||||| | ||||||||||||||||||  ||| || || ||||| ||||||||||| |||||||    
5129633 ggaggacttttgaatgcaacatgtgggaatgctacagaactcatcattgcaatatttgcacttagca 5129699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149757 times since January 2019
Visitors: 1518