View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_3 (Length: 568)

Name: NF0920_low_3
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_3
NF0920_low_3
[»] chr2 (16 HSPs)
chr2 (182-568)||(28215611-28215997)
chr2 (185-409)||(32565382-32565609)
chr2 (185-409)||(32806567-32806794)
chr2 (185-409)||(32815004-32815231)
chr2 (185-409)||(32309226-32309453)
chr2 (182-348)||(28220447-28220610)
chr2 (212-409)||(32799640-32799840)
chr2 (327-459)||(28220224-28220356)
chr2 (423-520)||(32309070-32309167)
chr2 (423-520)||(32799899-32799996)
chr2 (423-515)||(32565668-32565760)
chr2 (423-515)||(32806853-32806945)
chr2 (423-515)||(32815290-32815382)
chr2 (480-555)||(28220150-28220227)
chr2 (185-226)||(32305344-32305385)
chr2 (478-507)||(28216011-28216040)
[»] chr6 (2 HSPs)
chr6 (188-424)||(301362-301596)
chr6 (423-515)||(301229-301321)


Alignment Details
Target: chr2 (Bit Score: 375; Significance: 0; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 182 - 568
Target Start/End: Original strand, 28215611 - 28215997
Alignment:
182 ggaacctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatat 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
28215611 ggaacctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaacagcggaacgaacaatat 28215710  T
282 tctcagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaataccagctaactt 381  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28215711 tctcagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaataccagctaactt 28215810  T
382 gactgaacgaaaagaagtatgatagaaattaaatgaagttgttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttg 481  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28215811 cactgaacgaaaagaagtatgatagaaattaaatgaagttgttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttg 28215910  T
482 aagatgaagaatctcctcattttcttgatgatgatgatgctggagtgaaggagaagagaatagaagcgggaaagtgaagacttgttt 568  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
28215911 aagatgaagaatctcctcattttcttgatgatgatgatgctggagtgaaggagaagagaatagaagcaggaaagtgaagacttgttt 28215997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 185 - 409
Target Start/End: Original strand, 32565382 - 32565609
Alignment:
185 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattct 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||  |    
32565382 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcaaagtagatatcggtaacagcggaacgaacaatatctt 32565481  T
285 cagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaata---ccagctaactt 381  Q
    |||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||    | |||||  |    
32565482 cagcttgagggcaagaatccctatagaaattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctgctaaaat 32565581  T
382 gactgaacgaaaagaagtatgatagaaa 409  Q
    |||||||||||||||||||||| |||||    
32565582 gactgaacgaaaagaagtatgagagaaa 32565609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 185 - 409
Target Start/End: Original strand, 32806567 - 32806794
Alignment:
185 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattct 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||  |    
32806567 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcaaagtagatatcggtaacagcggaacgaacaatatctt 32806666  T
285 cagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaata---ccagctaactt 381  Q
    |||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||    | |||||  |    
32806667 cagcttgagggcaagaatccctatagaaattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctgctaaaat 32806766  T
382 gactgaacgaaaagaagtatgatagaaa 409  Q
    |||||||||||||||||||||| |||||    
32806767 gactgaacgaaaagaagtatgagagaaa 32806794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 185 - 409
Target Start/End: Original strand, 32815004 - 32815231
Alignment:
185 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattct 284  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||  |    
32815004 acctggatgaagcaatcatgaaagaaaagacgaagaagagaaggtgcaaggtctctatgatcaaagtagatatcggtaacagcggaacgaacaatatctt 32815103  T
285 cagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaata---ccagctaactt 381  Q
    |||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||    | |||||  |    
32815104 cagcttgagggcaagaatccctatagaaattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctgctaaaat 32815203  T
382 gactgaacgaaaagaagtatgatagaaa 409  Q
    |||||||||||||||||||||| |||||    
32815204 gactgaacgaaaagaagtatgagagaaa 32815231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 185 - 409
Target Start/End: Complemental strand, 32309453 - 32309226
Alignment:
185 acctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattct 284  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||| |||  |    
32309453 acctggatgaagcaatcatgaaagaaaagacgaagaagagaaggtgcaaggtctctatgatcaaagtagatatcggtaacagcggaacgaacattatctt 32309354  T
285 cagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaata---ccagctaactt 381  Q
    |||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||    | |||||  |    
32309353 cagcttgagggcaagaatccctatagaaattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctgctaaaat 32309254  T
382 gactgaacgaaaagaagtatgatagaaa 409  Q
    |||||||||||||||||||||| |||||    
32309253 gactgaacgaaaagaagtatgagagaaa 32309226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 182 - 348
Target Start/End: Complemental strand, 28220610 - 28220447
Alignment:
182 ggaacctggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatat 281  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||| | |||||||||||||||| ||||||||||||||||    
28220610 ggaacctggatgaagcaatcatgaaa--agagacgaagaagagaaggtgca-ggtctctatgattaaagtaaatatcggtaacagcggaacgaacaatat 28220514  T
282 tctcagcttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttc 348  Q
    ||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||    
28220513 tctcagcttgagggcaagaaaccttatagaaattatattgaagattggaaccatctctgattctttc 28220447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 212 - 409
Target Start/End: Original strand, 32799640 - 32799840
Alignment:
212 agacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattctcagcttcagggcaagaatccttataga 311  Q
    |||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||  ||||||| ||||||||||||| ||||||    
32799640 agacgaagaagagaaggtgcaaggtctctatgatcaaagtagatatcggtaacagcggaacgaacaatatcttcagcttgagggcaagaatccctataga 32799739  T
312 aattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaata---ccagctaacttgactgaacgaaaagaagtatgatagaa 408  Q
    |||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||    | |||||  ||||||||||||||||||||||| ||||    
32799740 aattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctgctaaaatgactgaacgaaaagaagtatgagagaa 32799839  T
409 a 409  Q
    |    
32799840 a 32799840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 327 - 459
Target Start/End: Complemental strand, 28220356 - 28220224
Alignment:
327 tggaaccatctctgatactttcactgaaatcaaacggaaaaataccagctaacttgactgaacgaaaagaagtatgatagaaattaaatgaagttgttct 426  Q
    |||||||||||||||| |||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28220356 tggaaccatctctgattctttgattgaaatcaaacggaaaaataccagctaacttcactgaacgaaaagaagtatgatagaaattaaatgaagttgttct 28220257  T
427 gagagagagaagaacaggaaggactgcaatgaa 459  Q
    ||||||||||||||||| |||||||||||||||    
28220256 gagagagagaagaacagaaaggactgcaatgaa 28220224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 423 - 520
Target Start/End: Complemental strand, 32309167 - 32309070
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatgatgatg 520  Q
    |||||||||||| |||||||||||||| | ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||    
32309167 ttctgagagagacaagaacaggaaggaatacaatgaatgcaactatgatccatgggttgaagatgaagaatctcctcattttcttgatgatgaagatg 32309070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 423 - 520
Target Start/End: Original strand, 32799899 - 32799996
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatgatgatg 520  Q
    ||||||||||||||||||||||||||| | ||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| ||||    
32799899 ttctgagagagagaagaacaggaaggaatacaatgaatgcaactatgaaccatgggttgaagatgaagaatctcctcattttcttgatgatgaagatg 32799996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 423 - 515
Target Start/End: Original strand, 32565668 - 32565760
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatga 515  Q
    |||||||||||| |||||||||||||| | ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
32565668 ttctgagagagacaagaacaggaaggaatacaatgaatgcaactatgatccatgggttgaagatgaagaatctcctcattttcttgatgatga 32565760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 423 - 515
Target Start/End: Original strand, 32806853 - 32806945
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatga 515  Q
    ||||||||||| ||||||||||||||| | ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
32806853 ttctgagagagggaagaacaggaaggaatacaatgaatgcaactatgatccatgggttgaagatgaagaatctcctcattttcttgatgatga 32806945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 423 - 515
Target Start/End: Original strand, 32815290 - 32815382
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatga 515  Q
    |||||||||||| |||||||||||||| | ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
32815290 ttctgagagagacaagaacaggaaggaatacaatgaatgcaactatgatccatgggttgaagatgaagaatctcctcattttcttgatgatga 32815382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 480 - 555
Target Start/End: Complemental strand, 28220227 - 28220150
Alignment:
480 tgaagatgaagaatctcctcattttcttgatgatgatgatgctggagtgaaggagaagagaat--agaagcgggaaag 555  Q
    |||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||| ||  |||||||||||||    
28220227 tgaagatgaagattctcctcattttcttgatgataatgatgctggattgaaggagaagaggataaagaagcgggaaag 28220150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 185 - 226
Target Start/End: Complemental strand, 32305385 - 32305344
Alignment:
185 acctggatgaagcaatcatgaaagaagagacgaagaagagaa 226  Q
    ||||||||||||||||||||||||||||||||||||||||||    
32305385 acctggatgaagcaatcatgaaagaagagacgaagaagagaa 32305344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 478 - 507
Target Start/End: Original strand, 28216011 - 28216040
Alignment:
478 gttgaagatgaagaatctcctcattttctt 507  Q
    ||||||||||||||||||||||||||||||    
28216011 gttgaagatgaagaatctcctcattttctt 28216040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 126; Significance: 1e-64; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 188 - 424
Target Start/End: Complemental strand, 301596 - 301362
Alignment:
188 tggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcagagtaaatatcggtaactgcggaacgaacaatattctcag 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||||||||||| |||||| |||||||||  ||||    
301596 tggatgaagcaatcatgaaagaagagacgaagaagagaaggtgcaaggtctctatgatcaaggtagatatcggtaacagcggaaggaacaatatcttcag 301497  T
288 cttcagggcaagaatccttatagaaattatatcgaagattggaaccatctctgatactttcactgaaatcaaacggaaaaataccagctaacttgactga 387  Q
    ||| ||||| ||||||| |||||||||||||| |||||||||||||||||||||| |||| | |||||||||| |||||| ||   |||||| |||||||    
301496 cttgagggctagaatccctatagaaattatattgaagattggaaccatctctgattctttgattgaaatcaaatggaaaagtattggctaacgtgactga 301397  T
388 acgaaaagaagtatgatagaaattaaatgaagttgtt 424  Q
    || |||||  |||||| |||||  | |||||||||||    
301396 accaaaag--gtatgagagaaagaagatgaagttgtt 301362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 423 - 515
Target Start/End: Complemental strand, 301321 - 301229
Alignment:
423 ttctgagagagagaagaacaggaaggactgcaatgaatgcaactaagatccatgtgttgaagatgaagaatctcctcattttcttgatgatga 515  Q
    |||||| |||||||||||| ||||||||| ||||||||||||||| || ||||| |||||||||||||||||| |||||||||||||||||||    
301321 ttctgaaagagagaagaacgggaaggactacaatgaatgcaactatgaaccatgggttgaagatgaagaatcttctcattttcttgatgatga 301229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142323 times since January 2019
Visitors: 1480