View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_32 (Length: 218)

Name: NF0920_low_32
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_32
NF0920_low_32
[»] chr5 (1 HSPs)
chr5 (16-218)||(12350565-12350767)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 12350767 - 12350565
Alignment:
16 acgacgatggcggaagaagaggcatggttgagcgcatgagaactgcgcccacataggagtatagcaaccccaaacagggtgaaaagatagcgcggagggg 115  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||    
12350767 acgacgatggcggaagaagaggcgtggttgagcgcatgagaactgcgcccacataagagtatagcaaccccaaacagggtgaaaagatagcgcagagggg 12350668  T
116 accttgttgcaccatcactgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggagcagagaggtcaga 215  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
12350667 accttgttgcaccatcgctgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggtcaga 12350568  T
216 gga 218  Q
    |||    
12350567 gga 12350565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149809 times since January 2019
Visitors: 1518