View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_33 (Length: 217)

Name: NF0920_low_33
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_33
NF0920_low_33
[»] chr5 (3 HSPs)
chr5 (1-133)||(39120111-39120249)
chr5 (5-124)||(38611334-38611453)
chr5 (1-126)||(39117903-39118028)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39120111 - 39120249
Alignment:
1 tggcactacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccct------ccctgtcccactatgttt 94  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||      ||||||||||||||||||    
39120111 tggcactacgatactgcaagtcactctgccacaagtttgtctgcgtttcaggttgtatatagtcgcaaacccccctccctgaccctgtcccactatgttt 39120210  T
95 ccaactccataatcagaaggtcctgaaccaagtattatc 133  Q
    |||||||||||||||| ||||||||||||||| ||||||    
39120211 ccaactccataatcagcaggtcctgaaccaagaattatc 39120249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 38611453 - 38611334
Alignment:
5 actacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccctccctgtcccactatgtttccaactccat 104  Q
    |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| || |||| || ||||||||||| |||||||||||||||||    
38611453 actacaatacagcaagtcactctgccacaggtttgtctgtgtttcaggttgtctatagtcgcgaaccaccttccctgtcccattatgtttccaactccat 38611354  T
105 aatcagaaggtcctgaacca 124  Q
    |||||| |||||||| ||||    
38611353 aatcagcaggtcctggacca 38611334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 39117903 - 39118028
Alignment:
1 tggcactacaatactgcaagtcactctgccacaggtttgtctgcgtttcaggttgtctatagttgcaaacccccctccctgtcccactatgtttccaact 100  Q
    ||||||| |||||| | |||||||||||||||||| ||||||| |||||||||||| |||||| || |||| |||||||||||||| | |||||||||||    
39117903 tggcacttcaatacaggaagtcactctgccacagggttgtctgtgtttcaggttgtttatagtcgcgaaccaccctccctgtcccattctgtttccaact 39118002  T
101 ccataatcagaaggtcctgaaccaag 126  Q
    |||||||| | |||||||| ||||||    
39118003 ccataatctgcaggtcctgtaccaag 39118028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142344 times since January 2019
Visitors: 1480