View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_34 (Length: 211)

Name: NF0920_low_34
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_34
NF0920_low_34
[»] chr3 (1 HSPs)
chr3 (1-143)||(7309687-7309829)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 7309687 - 7309829
Alignment:
1 tcatcaatcctatgtctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattttgagattcatcat 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7309687 tcatcaatcctatgcctatttcgataagaataatcagacgaagtttgtgtgctcattatttcatgatcattttcagaatcatcattttgagattcatcat 7309786  T
101 tcctacgtctctttcgagaactatatctttcatgatcatgatc 143  Q
    |||||||||||||||||||||||||||||||||||||||||||    
7309787 tcctacgtctctttcgagaactatatctttcatgatcatgatc 7309829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142256 times since January 2019
Visitors: 1479