View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_35 (Length: 206)

Name: NF0920_low_35
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_35
NF0920_low_35
[»] chr2 (14 HSPs)
chr2 (28-116)||(39952118-39952206)
chr2 (28-115)||(3436393-3436480)
chr2 (28-116)||(21647082-21647170)
chr2 (64-116)||(32493566-32493618)
chr2 (57-116)||(7634756-7634815)
chr2 (64-116)||(14660677-14660729)
chr2 (72-116)||(41670115-41670159)
chr2 (73-112)||(5997897-5997936)
chr2 (72-116)||(9621044-9621088)
chr2 (28-104)||(30378133-30378209)
chr2 (72-119)||(42461041-42461088)
chr2 (66-116)||(33891666-33891716)
chr2 (64-116)||(6201408-6201460)
chr2 (64-116)||(41399162-41399214)
[»] chr6 (11 HSPs)
chr6 (29-116)||(7793261-7793348)
chr6 (28-122)||(14529136-14529230)
chr6 (66-116)||(12650115-12650165)
chr6 (72-116)||(15584311-15584355)
chr6 (28-116)||(21381445-21381533)
chr6 (64-116)||(21955627-21955679)
chr6 (28-112)||(30792962-30793046)
chr6 (57-114)||(12158992-12159049)
chr6 (72-113)||(17186785-17186826)
chr6 (31-116)||(26289221-26289305)
chr6 (73-116)||(13246693-13246736)
[»] chr1 (15 HSPs)
chr1 (29-116)||(12628731-12628818)
chr1 (21-116)||(52042664-52042759)
chr1 (28-116)||(12880288-12880376)
chr1 (28-115)||(25891876-25891963)
chr1 (23-116)||(36700090-36700183)
chr1 (23-116)||(36716194-36716287)
chr1 (72-116)||(15802063-15802107)
chr1 (72-116)||(33015289-33015333)
chr1 (64-112)||(41812027-41812075)
chr1 (31-116)||(6492370-6492455)
chr1 (71-116)||(10891472-10891517)
chr1 (21-116)||(46284099-46284193)
chr1 (64-116)||(51161829-51161881)
chr1 (21-116)||(29152779-29152874)
chr1 (28-116)||(43413333-43413421)
[»] chr8 (18 HSPs)
chr8 (28-116)||(31801271-31801359)
chr8 (64-119)||(44400452-44400507)
chr8 (31-113)||(5335633-5335715)
chr8 (58-116)||(21511650-21511708)
chr8 (22-116)||(45364205-45364298)
chr8 (21-114)||(775373-775466)
chr8 (21-114)||(781027-781120)
chr8 (28-113)||(2179198-2179283)
chr8 (28-116)||(33561985-33562073)
chr8 (57-112)||(12177872-12177927)
chr8 (57-112)||(12422300-12422355)
chr8 (31-113)||(26988132-26988214)
chr8 (64-116)||(5967369-5967421)
chr8 (64-116)||(32821640-32821692)
chr8 (21-93)||(25328671-25328743)
chr8 (72-116)||(33937117-33937161)
chr8 (64-116)||(41636443-41636495)
chr8 (72-116)||(41844889-41844933)
[»] chr7 (19 HSPs)
chr7 (64-116)||(13954344-13954396)
chr7 (28-116)||(25317982-25318070)
chr7 (28-113)||(9157783-9157868)
chr7 (40-116)||(13953696-13953773)
chr7 (52-116)||(28919056-28919120)
chr7 (64-116)||(12392153-12392205)
chr7 (64-116)||(12408018-12408070)
chr7 (64-116)||(28606149-28606201)
chr7 (64-116)||(43094703-43094755)
chr7 (21-99)||(8319919-8319997)
chr7 (66-116)||(28606738-28606788)
chr7 (21-107)||(45234599-45234685)
chr7 (24-113)||(5277699-5277788)
chr7 (57-116)||(37597301-37597360)
chr7 (58-122)||(37668596-37668660)
chr7 (72-116)||(39679193-39679237)
chr7 (64-116)||(40952407-40952459)
chr7 (72-112)||(29782000-29782040)
chr7 (21-85)||(42834702-42834766)
[»] chr4 (12 HSPs)
chr4 (28-116)||(9686562-9686650)
chr4 (28-112)||(42746742-42746826)
chr4 (57-114)||(25142258-25142315)
chr4 (67-116)||(32156536-32156585)
chr4 (72-116)||(51717722-51717766)
chr4 (21-116)||(24970043-24970138)
chr4 (64-116)||(50679851-50679903)
chr4 (64-115)||(19300205-19300256)
chr4 (57-108)||(24234881-24234932)
chr4 (64-116)||(35321554-35321606)
chr4 (72-116)||(180515-180559)
chr4 (72-116)||(49491847-49491891)
[»] chr3 (23 HSPs)
chr3 (28-116)||(30847044-30847132)
chr3 (57-115)||(41118396-41118454)
chr3 (64-116)||(12113347-12113399)
chr3 (71-113)||(47257576-47257618)
chr3 (64-116)||(30738778-30738831)
chr3 (31-116)||(45406507-45406592)
chr3 (72-116)||(39993176-39993220)
chr3 (64-112)||(46552792-46552840)
chr3 (76-116)||(47117289-47117329)
chr3 (21-108)||(35924917-35925004)
chr3 (71-116)||(29251355-29251400)
chr3 (72-112)||(7719852-7719892)
chr3 (64-116)||(19680721-19680773)
chr3 (28-116)||(30433919-30434007)
chr3 (72-116)||(38751472-38751516)
chr3 (72-107)||(18431002-18431037)
chr3 (72-115)||(36735099-36735142)
chr3 (72-114)||(21696890-21696932)
chr3 (57-111)||(24475636-24475690)
chr3 (64-105)||(21224039-21224080)
chr3 (72-108)||(31681835-31681871)
chr3 (72-108)||(31916824-31916860)
chr3 (72-108)||(31950502-31950538)
[»] chr5 (15 HSPs)
chr5 (72-116)||(394371-394415)
chr5 (64-116)||(7861390-7861442)
chr5 (65-116)||(865632-865683)
chr5 (64-115)||(10378819-10378870)
chr5 (57-116)||(42522143-42522202)
chr5 (21-114)||(43583481-43583574)
chr5 (32-116)||(15834865-15834949)
chr5 (49-116)||(13146168-13146235)
chr5 (66-116)||(12220236-12220286)
chr5 (28-116)||(25825070-25825158)
chr5 (72-116)||(36080608-36080652)
chr5 (64-115)||(5841346-5841397)
chr5 (31-116)||(6812565-6812650)
chr5 (64-116)||(9771848-9771900)
chr5 (64-116)||(36977439-36977491)
[»] scaffold1505 (1 HSPs)
scaffold1505 (28-111)||(862-945)
[»] scaffold0024 (1 HSPs)
scaffold0024 (64-115)||(42225-42276)
[»] scaffold0070 (1 HSPs)
scaffold0070 (63-111)||(30098-30146)
[»] scaffold0743 (1 HSPs)
scaffold0743 (28-115)||(1277-1364)
[»] scaffold0027 (1 HSPs)
scaffold0027 (64-116)||(116687-116739)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 39952118 - 39952206
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||||||| |||  | |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
39952118 aaatttttaaggaaagcttcaaataaaaaatttatttgaataatttatcttaaaatgtcattctaagtatttcatcattttgttataat 39952206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 115
Target Start/End: Original strand, 3436393 - 3436480
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    ||||||| |||||||| ||  ||| ||| |||| | |||||| ||||||||||||||| |||||||||||||||||||||||||||||    
3436393 aaattttcaagaaaagcttcaaatgaaaaattcatttgaatagtttatcttaaaatgtcattctaagtatttcatcattttgttataa 3436480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 21647170 - 21647082
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||||| ||  ||||||| ||  || ||||||| |||||||||||||| ||||||  ||||||||||||||||||||||    
21647170 aaatttttaagaaaagtttcaaataaaaaatcggtttgaataacttatcttaaaatgtcattctagatatttcatcattttgttataat 21647082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 32493566 - 32493618
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
32493566 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttggttataat 32493618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 116
Target Start/End: Complemental strand, 7634815 - 7634756
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||  ||| |||||||||| ||||||||||||||||||||||||||||||    
7634815 attcgtttgaatagcttaacttaaaatgtcattctaagtatttcatcattttgttataat 7634756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 14660729 - 14660677
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||| ||||||| ||||||||    
14660729 tgaatagtttatcttaaaatgtcattctaagtattttatcatttggttataat 14660677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 41670115 - 41670159
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||    
41670115 ttatattaaaatgtcattctaagtatttcatcattttgttataat 41670159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 112
Target Start/End: Original strand, 5997897 - 5997936
Alignment:
73 tatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    ||||||||||||| ||||||||||||||||||||||||||    
5997897 tatcttaaaatgtcattctaagtatttcatcattttgtta 5997936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 9621088 - 9621044
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||| |||||||||||||| |||||||    
9621088 ttatcttaaaatgtcattctaaatatttcatcattttattataat 9621044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 104
Target Start/End: Original strand, 30378133 - 30378209
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatca 104  Q
    ||||||||||| |||| ||| ||| ||| |||  |||||||||  |||||||||||||||||| |||||||| ||||    
30378133 aaatttttaaggaaagttttaaatgaaaaattaatatgaataacctatcttaaaatgtaattcaaagtattttatca 30378209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 42461088 - 42461041
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataatatt 119  Q
    |||||||||||| | ||||||  |||||||||||||||||||||||||    
42461088 ttatcttaaaatatcattctagatatttcatcattttgttataatatt 42461041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 116
Target Start/End: Original strand, 33891666 - 33891716
Alignment:
66 aataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||||| | ||| ||| ||||||||||||||||||||||    
33891666 aatagtttatcttaaaatatcattataaatatttcatcattttgttataat 33891716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 6201460 - 6201408
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | ||| |||||||||||||||||  |||||||    
6201460 tgaatagtttatcttaaaatatcattataagtatttcatcatttgattataat 6201408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 41399214 - 41399162
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | |||||| |||||||| ||||| ||||||||    
41399214 tgaatagtttatcttaaaatatcattctaggtatttcaccatttggttataat 41399162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 52; Significance: 5e-21; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 7793348 - 7793261
Alignment:
29 aatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||| |||| || |||| ||| || ||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
7793348 aatttttaaggaaagtttcgaatgaaaaatccgtttgaatagtttatcttaaaatgtaagtctaagtatttcatcattttgttataat 7793261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 122
Target Start/End: Complemental strand, 14529230 - 14529136
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataatattctt 122  Q
    ||||||||||| |||| ||| ||| |||  || || |||| | ||||||||||||||| |||||||||||||||||||||| ||||||| |||||    
14529230 aaatttttaaggaaagtttttaatgaaaattttgtttgaaaagtttatcttaaaatgttattctaagtatttcatcattttattataattttctt 14529136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 116
Target Start/End: Original strand, 12650115 - 12650165
Alignment:
66 aataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||||||| ||| ||||||||||||||||||||||||||    
12650115 aatagtttatcttaaaatgtcattttaagtatttcatcattttgttataat 12650165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 15584311 - 15584355
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||| ||||||||||||||    
15584311 ttatcttaaaatgtcattctaagtatttcagcattttgttataat 15584355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 21381445 - 21381533
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||||||| ||  || | |||| ||||||||||||||| ||||||||||||| ||||||| ||||||||    
21381445 aaatttttaaggaaagcttcaaataaaaaatctgtttaaatagtttatcttaaaatgtcattctaagtattttatcatttggttataat 21381533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 21955679 - 21955627
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | ||||||||||||||||||||| ||||||||    
21955679 tgaatagtttatcttaaaatatcattctaagtatttcatcatttggttataat 21955627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 30793046 - 30792962
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    ||||||||||| |||| ||  ||| ||| || ||| ||||||| |||| ||||||||| |||||||||||||||| |||||||||    
30793046 aaatttttaaggaaagtttcaaatgaaaaatccgtttgaataacttattttaaaatgtcattctaagtatttcattattttgtta 30792962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 114
Target Start/End: Original strand, 12158992 - 12159049
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||||| ||||||| |||||||||||||| ||| ||| || |||||||||||||||||    
12158992 attcgtttgaataacttatcttaaaatgtcattttaaatagttcatcattttgttata 12159049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 113
Target Start/End: Original strand, 17186785 - 17186826
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    |||||||||||||| || ||||||||||||||||||||||||    
17186785 ttatcttaaaatgtcatgctaagtatttcatcattttgttat 17186826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 26289305 - 26289221
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| | ||| ||||||| ||| || ||||||| |||||||||||||| ||| ||| |||||  |||||||||||||||    
26289305 tttttaagaaa-gttttaaataaaaaatttgtttgaataacttatcttaaaatgtcattttaaatattttttcattttgttataat 26289221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 73 - 116
Target Start/End: Original strand, 13246693 - 13246736
Alignment:
73 tatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||| ||| ||||||||||||| ||||||||||||    
13246693 tatcttaaaatgtcattttaagtatttcatctttttgttataat 13246736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 15)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 12628818 - 12628731
Alignment:
29 aatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||| |||| ||| ||| ||| ||| || |||||| ||||||||||||||||||| ||||||||||||||||||||||||||    
12628818 aatttttaaggaaagttttaaatgaaaaatttgtttgaatagtttatcttaaaatgtaattttaagtatttcatcattttgttataat 12628731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 52042664 - 52042759
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||| |||||||| ||  ||||||| |||| | ||||||| |||||||||||||| |||||||| |||||||||||||||||||||    
52042664 aataaataaattttcaagaaaagtttcaaataaaaaattcatttgaataacttatcttaaaatgtcattctaagcatttcatcattttgttataat 52042759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 12880288 - 12880376
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||| ||| ||| || ||||||||||||||||||||| |||||||||||| ||||||||||||||||||    
12880288 aaatttttaaggaaagtttcaaatgaaaaatttgtttgaataatttatcttaaaatgcaattctaagtatctcatcattttgttataat 12880376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 115
Target Start/End: Original strand, 25891876 - 25891963
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    ||||||||||| |||| ||  ||||||| ||  || |||||| ||||||||||||||||||||||||||||| |||||||||||||||    
25891876 aaatttttaaggaaagtttctaataaaaaatctgtttgaatagtttatcttaaaatgtaattctaagtatttaatcattttgttataa 25891963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 116
Target Start/End: Complemental strand, 36700183 - 36700090
Alignment:
23 taaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||| ||| |||  ||| ||| || ||| | |||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
36700183 taaagaaatttttaaggaaaaattcaaatgaaaaatccgtttaaatagtttatcttaaaatgtcattctaagtatttcatcatttggttataat 36700090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 116
Target Start/End: Complemental strand, 36716287 - 36716194
Alignment:
23 taaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||| ||| |||  ||| ||| || ||| | |||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
36716287 taaagaaatttttaaggaaaaattcaaatgaaaaatccgtttaaatagtttatcttaaaatgtcattctaagtatttcatcatttggttataat 36716194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 15802107 - 15802063
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||    
15802107 ttatcttaaaatgtcattctaagtatttcatcattttgttataat 15802063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 33015333 - 33015289
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||    
33015333 ttatcttaaaatgtcattctaagtatttcatcattttgttataat 33015289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 112
Target Start/End: Original strand, 41812027 - 41812075
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    ||||||| |||||||||||||| ||||||||||||||||||||||||||    
41812027 tgaataacttatcttaaaatgtcattctaagtatttcatcattttgtta 41812075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 6492370 - 6492455
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||| |||| ||  ||| ||| ||| || ||||||| |||||||||||||| ||| || |||||||||||||||||||||||    
6492370 tttttaaggaaagcttaaaatgaaaaatttgtttgaataaattatcttaaaatgtcattttatgtatttcatcattttgttataat 6492455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 116
Target Start/End: Complemental strand, 10891517 - 10891472
Alignment:
71 tttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||||| ||||||||||||||||||||| ||||||||    
10891517 tttatcttaaaatgtcattctaagtatttcatcatttggttataat 10891472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 46284099 - 46284193
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| |||||||||||||||  ||  ||| ||| ||| || | |||||||||| ||||||||| ||||||| |||||||||||||| |||||||    
46284099 aataaagaaatttttaagaaaat-ttcaaatgaaaaatttgtttaaataatttattttaaaatgttattctaaatatttcatcattttattataat 46284193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 51161829 - 51161881
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| || |||||||||||| |||||||||||||||||||||  |||||||    
51161829 tgaatagttgatcttaaaatgtcattctaagtatttcatcatttgattataat 51161881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 29152779 - 29152874
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||  |||| ||  ||| |||  ||||| |||||| |||| |||||||||| |||   ||||||||||||||||||||||||    
29152779 aataaagaaatttttaaagaaagcttcaaatgaaaatttcgtttgaatagtttaacttaaaatgtcatttctagtatttcatcattttgttataat 29152874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 43413333 - 43413421
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||  ||  ||||||| |||||| |||||| ||||| || ||||   ||| ||||||||||||||||| ||||||||    
43413333 aaatttttaaggaaaacttcaaataaaaaattcgtttgaatagtttattttgaaataccattttaagtatttcatcatttggttataat 43413421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 18)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 31801359 - 31801271
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||  ||||||| ||| ||| || |||||| ||||||||||||||||||| | ||||||||||||||||||||||||    
31801359 aaatttttaaggaaaattttgaatgaaaaatttgtttgaatagtttatcttaaaatgtaatttttagtatttcatcattttgttataat 31801271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 64 - 119
Target Start/End: Original strand, 44400452 - 44400507
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataatatt 119  Q
    |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||    
44400452 tgaatagtttatcttaaaatataattctaagtatttcatcattttgttataatatt 44400507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 31 - 113
Target Start/End: Original strand, 5335633 - 5335715
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    ||||||||||||| ||| ||| ||| |||||| ||||||| ||| | | ||||| ||||||||||||||||||||||||||||    
5335633 tttttaagaaaagctttaaatgaaaaattcgtttgaataacttacccttaaatgcaattctaagtatttcatcattttgttat 5335715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 58 - 116
Target Start/End: Complemental strand, 21511708 - 21511650
Alignment:
58 ttcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||| ||||||  |||||||||||||| ||||||||||||||||||||||||||||||    
21511708 ttcgtttgaatagattatcttaaaatgtcattctaagtatttcatcattttgttataat 21511650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 116
Target Start/End: Original strand, 45364205 - 45364298
Alignment:
22 ataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||| ||||||||||| |||| ||  ||| ||| |||||| |||||| |||| |||||||||| ||| ||||||||||||||||||||||||||    
45364205 ataaagaaatttttaaggaaagctta-aatgaaaaattcgtttgaatagtttaacttaaaatgtcattttaagtatttcatcattttgttataat 45364298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 775466 - 775373
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||||| ||||||||||| ||| |||  ||| ||| |||||| ||||||| ||||||||||| ||   ||||||||||||||||||||||||||    
775466 aataaagaaatttttaaggaaatattcaaatgaaaaattcgtttgaataacttatcttaaaacgtctctctaagtatttcatcattttgttata 775373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 781120 - 781027
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||||| ||||||||||| ||| |||  ||| ||| |||||| ||||||| ||||||||||| ||   ||||||||||||||||||||||||||    
781120 aataaagaaatttttaaggaaatattcaaatgaaaaattcgtttgaataacttatcttaaaacgtctctctaagtatttcatcattttgttata 781027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 28 - 113
Target Start/End: Original strand, 2179198 - 2179283
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    ||||||||||| |||| ||  ||||||| ||  || ||||||| |||||||||||||| ||||||| |||||||||||||||||||    
2179198 aaatttttaaggaaagcttcaaataaaaaatgtgtttgaataacttatcttaaaatgtcattctaaatatttcatcattttgttat 2179283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 33562073 - 33561985
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||| ||| |||||| ||||||  |||||||||||||| ||| ||||||||| ||||||||||||||||    
33562073 aaatttttaaggaaagtttcaaatgaaaaattcgtttgaatatcttatcttaaaatgtcattataagtattttatcattttgttataat 33561985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 112
Target Start/End: Original strand, 12177872 - 12177927
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    |||||| ||||||| |||||||||||||| ||| ||||||||||||||||||||||    
12177872 attcgtttgaataacttatcttaaaatgtcattttaagtatttcatcattttgtta 12177927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 112
Target Start/End: Original strand, 12422300 - 12422355
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    |||||| ||||||| |||||||||||||| ||| ||||||||||||||||||||||    
12422300 attcgtttgaataacttatcttaaaatgtcattttaagtatttcatcattttgtta 12422355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 113
Target Start/End: Original strand, 26988132 - 26988214
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    ||||||||||||| ||| ||| ||| |||||| ||||||| ||| | | ||||| |||| |||||||||||||||||||||||    
26988132 tttttaagaaaagctttaaatgaaaaattcgtttgaataacttacccttaaatgcaattttaagtatttcatcattttgttat 26988214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 5967369 - 5967421
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||| ||||||||||||| ||||||||    
5967369 tgaatagtttatcttaaaatgtcattctaaatatttcatcatttggttataat 5967421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 32821640 - 32821692
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||| ||||||||| ||||||||||||||||||||| ||||||||    
32821640 tgaatagtttattttaaaatgtcattctaagtatttcatcatttggttataat 32821692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 93
Target Start/End: Original strand, 25328671 - 25328743
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaa 93  Q
    |||||| ||||||||||| |||| ||  ||| ||| ||| || ||||||| ||||||||||||||||||||||    
25328671 aataaagaaatttttaaggaaagcttcaaatgaaaaatttgtttgaataacttatcttaaaatgtaattctaa 25328743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 33937117 - 33937161
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||||||||||  ||||| ||||||||||||||||    
33937117 ttatcttaaaatgtaattctagatattttatcattttgttataat 33937161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 41636443 - 41636495
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| |||| |||||||||||||||| ||| ||||    
41636443 tgaatagtttatcttaaaatgtcattcaaagtatttcatcatttggttgtaat 41636495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 41844889 - 41844933
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||  ||||||||||||||||||||||    
41844889 ttatcttaaaatgtgattctagatatttcatcattttgttataat 41844933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 19)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 13954344 - 13954396
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
13954344 tgaatagtttatcttaaaatgtaattctaagtatttcatcattttgttataat 13954396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 25317982 - 25318070
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||||||  | |||| ||| | |||| |||||| ||||||||||||||||||| |||||||| |||||||||||||||||    
25317982 aaatttttaagaaaagtctcgaatgaaaaaatcgtttgaatagtttatcttaaaatgtaattttaagtattccatcattttgttataat 25318070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 28 - 113
Target Start/End: Complemental strand, 9157868 - 9157783
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    |||||||||||||||  ||  ||||||| ||| || ||||||||||||||||||| || ||||||||||||||||||||| |||||    
9157868 aaatttttaagaaaaacttcaaataaaaaatttgtttgaataatttatcttaaaaggtcattctaagtatttcatcatttggttat 9157783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 116
Target Start/End: Original strand, 13953696 - 13953773
Alignment:
40 aaagatttgaat-aaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||| |||| ||| || |||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
13953696 aaagttttgaatgaaaaaatttgtttgaatagtttatattaaaatgtaattctaagtatttcatcattttgttataat 13953773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 28919120 - 28919056
Alignment:
52 aaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| |||||| ||||||| |||||||||||||| ||||||| ||||||||||||||||||||||    
28919120 aaaaaattcgtttgaataacttatcttaaaatgtcattctaaatatttcatcattttgttataat 28919056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 12392153 - 12392205
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
12392153 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttcgttataat 12392205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 12408018 - 12408070
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
12408018 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttcgttataat 12408070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 28606149 - 28606201
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
28606149 tgaatagtttatcttaaaatgtgattctaagtatttcatcatttggttataat 28606201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 43094755 - 43094703
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||| ||||||||||||||||||||||||    
43094755 tgaatagtttatcttaaaatgtcattcttagtatttcatcattttgttataat 43094703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 99
Target Start/End: Original strand, 8319919 - 8319997
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtattt 99  Q
    |||||| |||||||||| ||||| ||| ||| ||| ||| || ||||||| |||||||||||||| |||||||||||||    
8319919 aataaagaaatttttaaaaaaagttttaaatgaaaaatttgtttgaataacttatcttaaaatgtcattctaagtattt 8319997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 116
Target Start/End: Complemental strand, 28606788 - 28606738
Alignment:
66 aataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||||||| ||||||||||||| ||||||||||||||||    
28606788 aatagtttatcttaaaatgtcattctaagtattttatcattttgttataat 28606738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 107
Target Start/End: Complemental strand, 45234685 - 45234599
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattt 107  Q
    |||||| ||||||| ||| |||| || |||| ||| ||| || | |||| ||||||||||||||| |||||||||||||||||||||    
45234685 aataaagaaattttcaaggaaagcttcgaatgaaaaatttgtttcaatagtttatcttaaaatgtcattctaagtatttcatcattt 45234599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 113
Target Start/End: Original strand, 5277699 - 5277788
Alignment:
24 aaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    ||||||||||| ||| |||| ||| | ||||| |||| | ||||||  |||||||||||||| ||||||| ||||||||||||| |||||    
5277699 aaacaaattttcaaggaaagctttaagtaaaaaattcatttgaatagcttatcttaaaatgtcattctaactatttcatcatttcgttat 5277788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 37597301 - 37597360
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||  ||| |||||||||| ||||||||||||||||||||| ||||||||    
37597301 attcgtttgaatagcttaacttaaaatgtcattctaagtatttcatcatttggttataat 37597360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 37668660 - 37668596
Alignment:
58 ttcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataatattctt 122  Q
    ||||| |||||| ||||||| ||||||| ||||||| ||||| ||||||||||| |||| |||||    
37668660 ttcgtttgaatagtttatctaaaaatgtcattctaaatattttatcattttgttgtaattttctt 37668596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 39679193 - 39679237
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||||||| ||||||||| || |||||||||||||    
39679193 ttatcttaaaatgtaattttaagtattttattattttgttataat 39679237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 40952459 - 40952407
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| |||||||||||||| |||| || ||||||||||||| |||||||||    
40952459 tgaatagtttatcttaaaatgaaattatatgtatttcatcattgtgttataat 40952407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 112
Target Start/End: Original strand, 29782000 - 29782040
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    |||||||||||||| ||||||| ||||| ||||||||||||    
29782000 ttatcttaaaatgttattctaaatattttatcattttgtta 29782040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 42834766 - 42834702
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgt 85  Q
    |||||| ||||||||||  |||| ||  ||| ||| |||||| ||||||||||||||||||||||    
42834766 aataaataaatttttaaagaaagcttcaaatgaaaaattcgtttgaataatttatcttaaaatgt 42834702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 9686650 - 9686562
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||| |||||||| || |||| ||| ||  || |||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
9686650 aaattttcaagaaaagtttcgaatgaaaaatatgtttgaatattttatcttaaaatgtaattctaagtattttatcattttgttataat 9686562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 42746826 - 42746742
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    ||||||||||| |||| ||  | |||||  ||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||    
42746826 aaatttttaaggaaagtttcaactaaaaatttcgtttgaataacttatcttaaaatataattctaagtatttcatcattttgtta 42746742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 57 - 114
Target Start/End: Complemental strand, 25142315 - 25142258
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||    
25142315 attcgtttgaataacttattttaaaatgtcattctaagtatttcatcattttgttata 25142258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 67 - 116
Target Start/End: Complemental strand, 32156585 - 32156536
Alignment:
67 ataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||||||||||||| |||||||||||||||||| |||||||    
32156585 ataatttatcttaaaatgtaattataagtatttcatcattttattataat 32156536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 51717766 - 51717722
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||    
51717766 ttatcttaaaatgtcattctaagtatttcatcattttgttataat 51717722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 24970138 - 24970043
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||| |||| ||  ||| ||| ||| || ||||||  ||| |||||||||| ||||||||||||||||||||| ||||||||    
24970138 aataaagaaatttttaaggaaagtttcaaatgaaaaatttgtttgaatagcttaacttaaaatgtcattctaagtatttcatcatttggttataat 24970043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 50679851 - 50679903
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | ||||||||||||||||||||| ||||||||    
50679851 tgaatagtttatcttaaaatatcattctaagtatttcatcatttggttataat 50679903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 64 - 115
Target Start/End: Complemental strand, 19300256 - 19300205
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||||||||||||||||| | ||||||||||||| || ||||||||||||    
19300256 tgaataatttatcttaaaatctcattctaagtattttatgattttgttataa 19300205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 24234932 - 24234881
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcatttt 108  Q
    |||||| ||||||| |||||||||||||| ||| ||||||||||||||||||    
24234932 attcgtttgaataacttatcttaaaatgtcattttaagtatttcatcatttt 24234881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 35321606 - 35321554
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||| ||||||||| ||||||| ||||||||||||| ||||||||    
35321606 tgaatagtttatattaaaatgtcattctaaatatttcatcatttggttataat 35321554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 180515 - 180559
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||| |  |||||||||||||||||||||| ||||||    
180515 ttatcttaaaatatcgttctaagtatttcatcattttggtataat 180559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 49491847 - 49491891
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||| |||||||| ||||||| ||| ||||||||||||||||||    
49491847 ttatcgtaaaatgtcattctaaatatctcatcattttgttataat 49491891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 23)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 30847132 - 30847044
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||| ||| ||| || ||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
30847132 aaatttttaaggaaagtttcaaatgaaaaatttgtttgaataacttatcttaaaatgtcattctaagtatttcatcattttgttataat 30847044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 41118396 - 41118454
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||    
41118396 attcgtttgaagaacttatcttaaaatgtaattctaagtatttcatcattttgttataa 41118454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 12113347 - 12113399
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||    
12113347 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttggttataat 12113399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 113
Target Start/End: Complemental strand, 47257618 - 47257576
Alignment:
71 tttatcttaaaatgtaattctaagtatttcatcattttgttat 113  Q
    ||||||||||||| |||||||||||||||||||||||||||||    
47257618 tttatcttaaaatataattctaagtatttcatcattttgttat 47257576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 30738831 - 30738778
Alignment:
64 tgaataatttatcttaaaa-tgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||    
30738831 tgaataacttatcttaaaaatgtcattctaagtatttcatcattttgttataat 30738778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 45406592 - 45406507
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||| |||| ||| ||||||| ||| || ||||||  |||||||||||| | ||| ||||||||| ||||||||||||||||    
45406592 tttttaaggaaagttttaaataaaaaattagtttgaatagcttatcttaaaatatcattgtaagtattttatcattttgttataat 45406507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 39993176 - 39993220
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||    
39993176 ttatcttaaaatgtcattctaagtatttcatcattttgttttaat 39993220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 112
Target Start/End: Complemental strand, 46552840 - 46552792
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| ||||    
46552840 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttggtta 46552792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 116
Target Start/End: Original strand, 47117289 - 47117329
Alignment:
76 cttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||||    
47117289 cttaaaatgtaattttaagtatttcatcattttgttataat 47117329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 108
Target Start/End: Complemental strand, 35925004 - 35924917
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcatttt 108  Q
    |||||| ||||||||||| |||| ||  ||||||| ||  || | ||||| |||||||||||| | ||||||||||||||||||||||    
35925004 aataaagaaatttttaaggaaagcttcaaataaaaaatctgtttaaataacttatcttaaaatatcattctaagtatttcatcatttt 35924917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 116
Target Start/End: Complemental strand, 29251400 - 29251355
Alignment:
71 tttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||| ||||| |||||||||||||||| |||||||||    
29251400 tttatcttaaaatataattataagtatttcatcattgtgttataat 29251355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 112
Target Start/End: Complemental strand, 7719892 - 7719852
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgtta 112  Q
    ||||||||||| || ||||||||||||||||||||||||||    
7719892 ttatcttaaaacgtcattctaagtatttcatcattttgtta 7719852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 19680721 - 19680773
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| ||| ||| |||||| |||||||||||||||    
19680721 tgaatagtttatcttaaaatgtcattttaaatatttcgtcattttgttataat 19680773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 30433919 - 30434007
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||| |||| ||  ||||||| |||  | ||||||  |||||||||||||| ||| ||  ||||||||||||||||||||||    
30433919 aaatttttaaggaaagcttcaaataaaaaattgatttgaatagcttatcttaaaatgtcattttagatatttcatcattttgttataat 30434007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 38751516 - 38751472
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||  ||||||||||||||||||||||    
38751516 ttatcttaaaatgtgattctagatatttcatcattttgttataat 38751472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 72 - 107
Target Start/End: Complemental strand, 18431037 - 18431002
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattt 107  Q
    |||||||||||||| |||||||||||||||||||||    
18431037 ttatcttaaaatgttattctaagtatttcatcattt 18431002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 72 - 115
Target Start/End: Complemental strand, 36735142 - 36735099
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||||||||||| ||||||  |||||||||||||||||||||    
36735142 ttatcttaaaatgttattctagatatttcatcattttgttataa 36735099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 21696932 - 21696890
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||| ||||||||| ||||||||||||||||| ||||||||||    
21696932 ttattttaaaatgtcattctaagtatttcatctttttgttata 21696890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 24475690 - 24475636
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtt 111  Q
    |||||| ||||||  ||||||||||| || ||||||| |||||||||||||||||    
24475690 attcgtttgaatagcttatcttaaaacgtcattctaaatatttcatcattttgtt 24475636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 21224039 - 21224080
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcat 105  Q
    |||||| ||||||||||||| | |||||||||||||||||||    
21224039 tgaatagtttatcttaaaatatcattctaagtatttcatcat 21224080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 31681871 - 31681835
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcatttt 108  Q
    |||||||||||||| ||||||||||||||| ||||||    
31681871 ttatcttaaaatgtcattctaagtatttcaacatttt 31681835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 108
Target Start/End: Original strand, 31916824 - 31916860
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcatttt 108  Q
    |||||||||||||| ||||||||||||||| ||||||    
31916824 ttatcttaaaatgtcattctaagtatttcaacatttt 31916860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 108
Target Start/End: Original strand, 31950502 - 31950538
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcatttt 108  Q
    |||||||||||||| ||||||||||||||| ||||||    
31950502 ttatcttaaaatgtcattctaagtatttcaacatttt 31950538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 394415 - 394371
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||    
394415 ttatcttaaaatgtcattctaagtatttcatcattttgttataat 394371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 7861442 - 7861390
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||||| |||||||||||||||||| |||||||||||    
7861442 tgaatagtttatcttaaaatgtcattctaagtatttcatcagtttgttataat 7861390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 65 - 116
Target Start/End: Original strand, 865632 - 865683
Alignment:
65 gaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||||||||||||||| ||||||||||||| ||||||| ||||||||    
865632 gaataatttatcttaaaatgtcattctaagtattttatcatttggttataat 865683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 64 - 115
Target Start/End: Complemental strand, 10378870 - 10378819
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||| ||||||||||||||| ||||||||||||||||| |||||||||||    
10378870 tgaatagtttatcttaaaatgtcattctaagtatttcatcgttttgttataa 10378819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 42522143 - 42522202
Alignment:
57 attcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||  |||||||||||||| |||||||||||||||||||||| |||||||    
42522143 attcgtttgaatagcttatcttaaaatgtcattctaagtatttcatcattttattataat 42522202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 114
Target Start/End: Original strand, 43583481 - 43583574
Alignment:
21 aataaacaaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttata 114  Q
    |||||| ||| |||||| |||| |||  ||| ||| |||||| ||||||| |||||| |||||||   ||||||||||||||||||||||||||    
43583481 aataaagaaacttttaaaaaaatattcaaatgaaaaattcgtttgaataacttatctaaaaatgtctctctaagtatttcatcattttgttata 43583574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 15834949 - 15834865
Alignment:
32 ttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||| |||| ||  ||||||| ||| || |||||| ||||||||||||||| ||||||  ||||| ||||||||||||||||    
15834949 ttttaaggaaagcttcaaataaaaaattggtttgaatagtttatcttaaaatgtcattctagatattttatcattttgttataat 15834865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 116
Target Start/End: Original strand, 13146168 - 13146235
Alignment:
49 aataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||| || ||| |||||| ||||||||||||||| ||||||| |||||||||||||  |||||||    
13146168 aataaaaaatccgtttgaatagtttatcttaaaatgtcattctaaatatttcatcatttgcttataat 13146235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 66 - 116
Target Start/End: Original strand, 12220236 - 12220286
Alignment:
66 aataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||| ||||||||||||| | ||||||||||||||||||||| ||||||||    
12220236 aatagtttatcttaaaatatcattctaagtatttcatcatttggttataat 12220286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 116
Target Start/End: Complemental strand, 25825158 - 25825070
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||||||| | |||| ||  ||||||| ||| || ||||||  |||||||||||||| |||||   ||||||||||||||||||||||    
25825158 aaatttttagggaaagcttcaaataaaaaattggtttgaatagcttatcttaaaatgtgattctcgatatttcatcattttgttataat 25825070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 36080608 - 36080652
Alignment:
72 ttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||||||||| |  |||||||||||||||||||||||||||||    
36080608 ttatcttaaaatatcgttctaagtatttcatcattttgttataat 36080652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 64 - 115
Target Start/End: Original strand, 5841346 - 5841397
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||| ||||||||| ||| | ||||||||||||||||||||| |||||||    
5841346 tgaatagtttatcttagaatatcattctaagtatttcatcatttggttataa 5841397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 6812565 - 6812650
Alignment:
31 tttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    ||||| || |||| ||||||||||| ||  |  ||||||  |||||||||||| | ||||||  ||||||||||||||||||||||    
6812565 tttttcaggaaagttttgaataaaaaatcggcttgaatagcttatcttaaaatatcattctagatatttcatcattttgttataat 6812650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 9771900 - 9771848
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | ||| ||||||||||||||||  ||||||||    
9771900 tgaatagtttatcttaaaatcttattataagtatttcatcattgggttataat 9771848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 36977439 - 36977491
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||| ||||||||| ||| ||||||||||||||||| | ||||||    
36977439 tgaatagtttattttaaaatgtcattttaagtatttcatcatttggctataat 36977491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1505 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold1505
Description:

Target: scaffold1505; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 28 - 111
Target Start/End: Complemental strand, 945 - 862
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgtt 111  Q
    ||||||||||| |||| ||  ||| ||| ||| || ||||||| ||||||||||||||||||||||  ||||||||||||||||    
945 aaatttttaaggaaagtttcaaatgaaaaatttgtttgaataacttatcttaaaatgtaattctaaaaatttcatcattttgtt 862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 64 - 115
Target Start/End: Complemental strand, 42276 - 42225
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    |||||| ||||||||||||||| ||||||||||||||||||||| |||||||    
42276 tgaatagtttatcttaaaatgtcattctaagtatttcatcatttggttataa 42225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 30146 - 30098
Alignment:
63 atgaataatttatcttaaaatgtaattctaagtatttcatcattttgtt 111  Q
    ||||| |||||||||||||||||||||||||  ||||||||||||||||    
30146 atgaaaaatttatcttaaaatgtaattctaaaaatttcatcattttgtt 30098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0743 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0743
Description:

Target: scaffold0743; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 115
Target Start/End: Original strand, 1277 - 1364
Alignment:
28 aaatttttaagaaaagatttgaataaaatattcgtatgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataa 115  Q
    ||||||||||| |||| || ||||  || |||| ||||||||| |||| | |||||| ||||| || |||||||||||||||||||||    
1277 aaatttttaaggaaagtttcgaatggaaaattcatatgaataacttatataaaaatgcaattcaaaatatttcatcattttgttataa 1364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 116687 - 116739
Alignment:
64 tgaataatttatcttaaaatgtaattctaagtatttcatcattttgttataat 116  Q
    |||||| ||||||||||||| | ||  ||||||||||||||||||||||||||    
116687 tgaatagtttatcttaaaatatcatcttaagtatttcatcattttgttataat 116739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142191 times since January 2019
Visitors: 1479