View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_4 (Length: 554)

Name: NF0920_low_4
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_4
[»] chr2 (1 HSPs)
chr2 (75-546)||(15885619-15886089)
[»] chr6 (1 HSPs)
chr6 (408-541)||(28958926-28959059)
[»] chr8 (1 HSPs)
chr8 (257-308)||(8942306-8942357)

Alignment Details
Target: chr2 (Bit Score: 444; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 444; E-Value: 0
Query Start/End: Original strand, 75 - 546
Target Start/End: Complemental strand, 15886089 - 15885619
75 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 174  Q
15886089 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 15885990  T
175 agaggggtctccttgccttaaccctctaccagaaataaaaggaacaggtgtgctaccattaaacaaaatagaataatttacggtttcaacacacatcata 274  Q
    |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885989 agaggggtctccttgccttaaccctctaccaggaataaaaggtacaggtgtgctaccattaaacaaaatagaataatttacggtttcaacacacatcata 15885890  T
275 atccatttgttctattgatgagagaaactcatttccatcataacccctttgagataattcaagtcaattatgtcctatgtcttgctaatatcaagcttca 374  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
15885889 atccatt-gttctattgatgagaaaaactcatttccatcataacccctttgagataattcaagtcaattatgtccgatgtcttgctaatatcaagcttca 15885791  T
375 aaacaacatcgccatattttcctctaacttttacatagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgt 474  Q
15885790 aaacaacatcgccatattttcctctaacttttacatagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgt 15885691  T
475 ttgtcatgttgacggttgatgggaaaatacatgtcaaaagccaaccacaccattgattacaaatttcatctc 546  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885690 ttttcatgttgacggttgatgggaaaatacatgtcaaaagccaaccacaccattgattacaaatttcatctc 15885619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 408 - 541
Target Start/End: Complemental strand, 28959059 - 28958926
408 catagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgtttgtcatgttgacggttgatgggaaaatacatg 507  Q
    |||||||||||||||||| |||||||||||||||||| | | ||||||||| | |||||||  ||||||||||| || | ||||||||||||| || |||    
28959059 catagagcaataggtcactaatctttcatagaaactttggactcacctttttggattagggatatgtttgtcatatttaaggttgatgggaaagtaaatg 28958960  T
508 tcaaaagccaaccacaccattgattacaaatttc 541  Q
    |  |||||||||| ||  |||||||| |||||||    
28958959 ttgaaagccaaccgcaatattgattaaaaatttc 28958926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 257 - 308
Target Start/End: Complemental strand, 8942357 - 8942306
257 gtttcaacacacatcataatccatttgttctattgatgagagaaactcattt 308  Q
    ||||| ||||||||||| ||||| ||| ||||||||||||| ||||||||||    
8942357 gtttctacacacatcatgatccacttgatctattgatgagataaactcattt 8942306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149783 times since January 2019
Visitors: 1518