View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_6 (Length: 538)

Name: NF0920_low_6
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_6
[»] chr1 (1 HSPs)
chr1 (37-523)||(10794462-10794948)

Alignment Details
Target: chr1 (Bit Score: 467; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 467; E-Value: 0
Query Start/End: Original strand, 37 - 523
Target Start/End: Original strand, 10794462 - 10794948
37 tatataaagattttgttgatgaataatctgttaatgcatctttcaacgttcttaagaagtattttcgattttgttttttaatatatgatcatagaagcta 136  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||    
10794462 tatataaagattttgttgatgaataatatgttaatgcatctttcaacgttcttaagaagtattttcgattttgttttttaacatatgatcagagaagcta 10794561  T
137 cgcaaatagaatatggggtaattatgtgtcagaaaaaagaaagaatgtgggggttatttcttatttgagccaagattataacctaattgtgccaaaattc 236  Q
10794562 cgcaaatagaatatggggtaattatgtgtcagaaaaaagaaagaatgtgggggttatttcttatttgagccaagattataacctaattgtgccaaaattc 10794661  T
237 aaccaccaaatgaagccaaaatcaaattattgataatgaggtgtgaaggaatgtggatttatgcgcatagtggaccccacattttacaccagccacatgc 336  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
10794662 aaccaccaaatgaagccaaaatcaaattattgatattgaggtgtgaaggaatgtggatttatgcgcataatggaccccacattttacaccagccacatgc 10794761  T
337 taatggagttcacatttccaaaaaagatagacctctccaataaaggacaattagaacaagtgtccctcactccaattttctcaaaaccataattaaatat 436  Q
10794762 taatggagttcacatttccaaaaaagatagacctctccaataaaggacaattagaacaagtgtccctcactccaattttctcaaaaccataattaaatat 10794861  T
437 acctaaacccaaaagtcccttttacatatacatactttacattttcatatgtacctaacaacttaagaaatcctttactttcctcat 523  Q
10794862 acctaaacccaaaagtcccttttacatatacatactttacattttcatatgtacctaacaacttaagaaatcctttactttcctcat 10794948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 141867 times since January 2019
Visitors: 1478