View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_7 (Length: 440)

Name: NF0920_low_7
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_low_7
[»] chr4 (10 HSPs)
chr4 (47-407)||(30264171-30264531)
chr4 (47-407)||(30287657-30288017)
chr4 (225-440)||(30032301-30032516)
chr4 (225-432)||(30048547-30048754)
chr4 (225-432)||(30062888-30063095)
chr4 (61-407)||(30280764-30281110)
chr4 (61-407)||(30304146-30304492)
chr4 (61-407)||(30271079-30271425)
chr4 (225-430)||(30228686-30228891)
chr4 (225-432)||(30220171-30220378)
[»] scaffold0024 (2 HSPs)
scaffold0024 (238-399)||(79534-79695)
scaffold0024 (274-399)||(72506-72631)
[»] chr7 (2 HSPs)
chr7 (225-337)||(2311376-2311488)
chr7 (226-326)||(29483193-29483293)

Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 10)
Name: chr4

Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 47 - 407
Target Start/End: Original strand, 30264171 - 30264531
47 gcagaacctgtgaaccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaatt 146  Q
    |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
30264171 gcagaaactctgaaccttcctcaccattccatataggtgatttatcatcttcaattattgaacttttcaatatactccatccaaaatcagagattgaatt 30264270  T
147 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 246  Q
30264271 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 30264370  T
247 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcat 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30264371 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgtaagcagcat 30264470  T
347 tggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || |||||||||| ||||||| ||| ||||||||||| ||||| |||| |||||| |||||    
30264471 tgcttgttggatacttgataacatgtatttcccaaaggggtttgtcttttggtgtcctttc 30264531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 47 - 407
Target Start/End: Complemental strand, 30288017 - 30287657
47 gcagaacctgtgaaccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaatt 146  Q
    |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
30288017 gcagaaactctgaaccttcctcaccattccatataggtgatttatcatcttcaattattgaacttttcaatatactccatccaaaatcagagattgaatt 30287918  T
147 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 246  Q
30287917 gaaaagggagaatatggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaa 30287818  T
247 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcat 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30287817 ggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgtaagcagcat 30287718  T
347 tggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || |||||||||| ||||||| ||| ||||||||||| ||||| |||| |||||| |||||    
30287717 tgcttgttggatacttgataacatgtatttcccaaaggggtttgtcttttggtgtcctttc 30287657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 225 - 440
Target Start/End: Original strand, 30032301 - 30032516
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
30032301 aggaaaagataaaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccgtcaccaagtgcatgatgaagtttg 30032400  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30032401 aatattatggtgcaagcttcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 30032500  T
425 catagtcattaaaata 440  Q
30032501 catagtcattaaaata 30032516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 225 - 432
Target Start/End: Original strand, 30048547 - 30048754
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
30048547 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtccatgatgaagtttg 30048646  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
30048647 aatattatggtgcaagcagcattggttgttggataattgataacatgaatttcccaaagtggtttatcttgtggtgtttttttagctagaatacttgtta 30048746  T
425 catagtca 432  Q
30048747 catagtca 30048754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 225 - 432
Target Start/End: Original strand, 30062888 - 30063095
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
30062888 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtccatgatgaagtttg 30062987  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
30062988 aatattatggtgcaagcagcattggttgttggataattgataacatgaatttcccaaagtggtttatcttgtggtgtttttttagctagaatacttgtta 30063087  T
425 catagtca 432  Q
30063088 catagtca 30063095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 61 - 407
Target Start/End: Complemental strand, 30281110 - 30280764
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| ||||||||    
30281110 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggagaata 30281011  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    |||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||||||||    
30281010 tggttgaaggaaaccacttgaaaaaacctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcagctct 30280911  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||| ||||||||||     
30280910 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcattgcttgttggatat 30280811  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30280810 ttaattaaatgcatttcccaaagtggtttgtcttgtggtgttctttc 30280764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 61 - 407
Target Start/End: Original strand, 30304146 - 30304492
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| || |||||    
30304146 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggggaata 30304245  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||| ||||    
30304246 tggttgaagggaaccacttgaaaaagcctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcaactct 30304345  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||| ||||||||||     
30304346 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcattgcttgttggatat 30304445  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30304446 ttaattaaatgcatttcccaaagtggtttgtcttgtggtgttctttc 30304492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 61 - 407
Target Start/End: Original strand, 30271079 - 30271425
61 ccttcgtcaccattccatataggtgatttatcatcttcaattattgaacctttcaatatgctccatccaaaatcagagattgaattgaaaagggagaata 160  Q
    ||||| ||||||||||||||||||| ||| ||||||| ||  ||||| | |||   |||||||||||||||||||||||  |||||||||| ||||||||    
30271079 ccttcctcaccattccatataggtgttttgtcatctttaagcattgagcttttggctatgctccatccaaaatcagagaaggaattgaaaaaggagaata 30271178  T
161 tggttgaagggaaccacttgaaaaagcctctcttgggagttaacaattgtgatgacttgcggttaggaaaagacaaaggaagagaaggatcatcagctct 260  Q
    |||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||  |||||   |||||||||||||||||||||||| |||||||||||    
30271179 tggttgaaggaaaccacttgaaaaaacctttcttgggagataacaattgtgatggtttgcgtgaaggaaaagacaaaggaagagaagggtcatcagctct 30271278  T
261 atgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataa 360  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |  || |    ||||||  ||||||||||     
30271279 ttgtagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttgaatatcaaagttcctttagcatttcttgttggatat 30271378  T
361 ttgataatatgaatttcccaaagtggtttatcttgtggtgttctttc 407  Q
    || || | ||| ||||||||||||||||| |||||||||||||||||    
30271379 ttaattaaatgtatttcccaaagtggtttgtcttgtggtgttctttc 30271425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 225 - 430
Target Start/End: Original strand, 30228686 - 30228891
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
30228686 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcactcatgagagagtaaccatcaccaagtgcatgattaagtttg 30228785  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||  ||||||||||||||    
30228786 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttattttgtggtgttcttccatttagaatacttgtta 30228885  T
425 catagt 430  Q
30228886 catagt 30228891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 225 - 432
Target Start/End: Complemental strand, 30220378 - 30220171
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
30220378 aggaaaagatagaggaagagaaggatcatcagctctttgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatggtgaagtttg 30220279  T
325 aatattatggtgcaagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggtgttctttcagctagaatacttgtta 424  Q
    ||||| |  || |    ||||||| |||||||||| || || | ||||||||||||||| ||||||||||| |||||||||  || ||||||||||||||    
30220278 aatatcaaagttcctttagcattgcttgttggatatttaatcaaatgaatttcccaaaggggtttatcttgaggtgttcttgaagttagaatacttgtta 30220179  T
425 catagtca 432  Q
30220178 catagtca 30220171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 74; Significance: 9e-34; HSPs: 2)
Name: scaffold0024

Target: scaffold0024; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 238 - 399
Target Start/End: Original strand, 79534 - 79695
238 ggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgc 337  Q
    ||||||||||| | ||||||||| |  | ||| |||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| || ||| |    
79534 ggaagagaagggttatcagctctttctaaacatgaaagaagtgcacccattagagagtaaccatctccaagtgcatgatgaagtttgaatactaaggtac 79633  T
338 aagcagcattggttgttggataattgataatatgaatttcccaaagtggtttatcttgtggt 399  Q
     ||| |||||  |||||||||| || |||||||| || |||||||||||| |||||||||||    
79634 cagctgcattttttgttggatatttaataatatgtatctcccaaagtggtctatcttgtggt 79695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 274 - 399
Target Start/End: Original strand, 72506 - 72631
274 agaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttgaatattatggtgcaagcagcattggttgttggataattgataatatgaa 373  Q
    |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| || ||| | ||| |||||  |||||||||| || ||||||||||    
72506 agaagagctcccattagagagtaaccatctccaagtgcatgatgaagtttgaatactaaggtaccagctgcattttttgttggatatttaataatatgaa 72605  T
374 tttcccaaagtggtttatcttgtggt 399  Q
    ||||||| |||||| |||||||||||    
72606 tttcccatagtggtctatcttgtggt 72631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 225 - 337
Target Start/End: Complemental strand, 2311488 - 2311376
225 aggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttg 324  Q
    ||||||||||||||||||||| ||||||||||| |  || |||||||||||||| |||||||| ||||| |||||||| ||||||||||| |||||||||    
2311488 aggaaaagacaaaggaagagatggatcatcagcacgttgtagacaagaaagaagtgcacccattagagaataaccatctccaagtgcatggtgaagtttg 2311389  T
325 aatattatggtgc 337  Q
    |||||||| ||||    
2311388 aatattattgtgc 2311376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 326
Target Start/End: Original strand, 29483193 - 29483293
226 ggaaaagacaaaggaagagaaggatcatcagctctatgaagacaagaaagaagagcacccatgagagagtaaccatcaccaagtgcatgatgaagtttga 325  Q
    ||||| |||||| | |||||||||||||||||||| ||||| |  |||||||   |||||||||||  ||| ||||| |||| |||||| |||| |||||    
29483193 ggaaaggacaaacggagagaaggatcatcagctctttgaaggctcgaaagaatgacacccatgagattgtagccatctccaattgcatggtgaaatttga 29483292  T
326 a 326  Q
29483293 a 29483293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149101 times since January 2019
Visitors: 1516