View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_low_8 (Length: 416)

Name: NF0920_low_8
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_low_8
NF0920_low_8
[»] chr8 (7 HSPs)
chr8 (13-416)||(8723724-8724137)
chr8 (223-416)||(8740365-8740558)
chr8 (203-416)||(14372225-14372438)
chr8 (215-416)||(8705289-8705490)
chr8 (196-296)||(8691129-8691229)
chr8 (40-123)||(8722621-8722702)
chr8 (249-342)||(8722440-8722533)
[»] scaffold0384 (1 HSPs)
scaffold0384 (179-243)||(7682-7746)


Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 13 - 416
Target Start/End: Complemental strand, 8724137 - 8723724
Alignment:
13 aatatgacactaagagaaaa-ggggttcaaaatcaaattttcaaacaatgaatccaaacatcttcaaatttcagaacaacctatcagataagaaatatat 111  Q
    ||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||    
8724137 aatatgacactaaaagaaaaaggggttcaaaatcaaattttcaaagaatgaatccaatcatcttcaaatttcagaacagcctatcagataagaaatatat 8724038  T
112 caaatcctgaaaggaaaaa-caca---------atactcatttcatttctagtgattaaagaatattttnnnnnnntgttacatattaaaagcattaaaa 201  Q
    ||||||||||||| ||||| ||||         |||||||||||||||||||||||||||||||||||        ||||| ||||||||||||||||||    
8724037 caaatcctgaaagaaaaaaacacatacaatactatactcatttcatttctagtgattaaagaatatttaaaaaaaatgtta-atattaaaagcattaaaa 8723939  T
202 gttaaaaccttaatgtagcaaaacaaacctggggatcatcaaaggtgacatcatgatactcatgaatgacccaattggtcttaacaccaggaacaggatt 301  Q
    ||||||||||||||||| ||||||||||||||| ||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||    
8723938 gttaaaaccttaatgtaacaaaacaaacctgggaatcctctaaggtgacatcatgatactcatgaatgatccaattggtcttaacaccaggaacatgatt 8723839  T
302 ttcatggtaaacaagagtcttcttaatcccaataacttcattggtacccctaatcctaatgttacggtccattccagtagctttccaaaagccattctta 401  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||    
8723838 ctcatggtaaacaagagtcttcttaatcccaataacttcattggtacccctaatcctaatgttacggtccattccagtagctttccaaaaaccattatta 8723739  T
402 gttgtccttttaaac 416  Q
    |||||||||||||||    
8723738 gttgtccttttaaac 8723724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 223 - 416
Target Start/End: Complemental strand, 8740558 - 8740365
Alignment:
223 aacaaacctggggatcatcaaaggtgacatcatgatactcatgaatgacccaattggtcttaacaccaggaacaggattttcatggtaaacaagagtctt 322  Q
    ||||||||||| ||||||||||| || |||||||||| |||||||||| |||||| |||||||||||||||||||||| |||||| ||||||||||||||    
8740558 aacaaacctggtgatcatcaaagatggcatcatgatattcatgaatgatccaattagtcttaacaccaggaacaggatcttcatgataaacaagagtctt 8740459  T
323 cttaatcccaataacttcattggtacccctaatcctaatgttacggtccattccagtagctttccaaaagccattcttagttgtccttttaaac 416  Q
    |||| ||||||||| || ||||||||| |||||| ||||| |||| ||  ||||||||||||||||||| ||||| || |||||||||||||||    
8740458 cttagtcccaataattttattggtacctctaatcttaatgctacgatcatttccagtagctttccaaaaaccattattcgttgtccttttaaac 8740365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 203 - 416
Target Start/End: Original strand, 14372225 - 14372438
Alignment:
203 ttaaaaccttaat-gtagcaaaacaaacctggggatcatcaaaggtgacatcatgatactcatgaatgacccaattggtcttaacaccaggaacaggatt 301  Q
    |||||||||| || ||| ||||||||||||||  ||| |||||||||  ||||||||| |||||||| ||||   || | ||||||||||||||| ||      
14372225 ttaaaacctttattgtaacaaaacaaacctggt-atcttcaaaggtggtatcatgatattcatgaatcacccggctgcttttaacaccaggaacacgacc 14372323  T
302 ttcatggtaaacaagagtcttcttaatcccaataacttcattggtacccctaatcctaatgttacggtccattccagtagctttccaaaagccattctta 401  Q
     | || |||||||||||| ||||||||||||||||  | |||| ||||||||| | |||| || |||||| ||||||||||||||||||| ||||| ||     
14372324 attatagtaaacaagagttttcttaatcccaataatattattgctacccctaaccttaatcttccggtcctttccagtagctttccaaaaaccatttttt 14372423  T
402 gttgtccttttaaac 416  Q
    |||||||||||||||    
14372424 gttgtccttttaaac 14372438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 215 - 416
Target Start/End: Complemental strand, 8705490 - 8705289
Alignment:
215 tgtagcaaaacaaacctggggatcatcaaaggtgacatcatgatactcatgaatgacccaattggtcttaacaccaggaacaggattttcatggtaaaca 314  Q
    |||| |||||||||||| |  ||| |||||||||  ||||||||| |||||||| |||||  || | ||||||||||||||| ||   |  | |||||||    
8705490 tgtaacaaaacaaaccttgtcatcttcaaaggtggtatcatgatattcatgaatcacccagctgcttttaacaccaggaacacgaccattgtagtaaaca 8705391  T
315 agagtcttcttaatcccaataacttcattggtacccctaatcctaatgttacggtccattccagtagctttccaaaagccattcttagttgtccttttaa 414  Q
    ||||||||||||||||||||||  | |||| ||||||||| | |||| || |||||| | ||||||||||||||||| ||| | || |||||||| ||||    
8705390 agagtcttcttaatcccaataatattattgctacccctaaccttaatcttccggtccttaccagtagctttccaaaaaccagtatttgttgtcctcttaa 8705291  T
415 ac 416  Q
    ||    
8705290 ac 8705289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 196 - 296
Target Start/End: Complemental strand, 8691229 - 8691129
Alignment:
196 ttaaaagttaaaaccttaatgtagcaaaacaaacctggggatcatcaaaggtgacatcatgatactcatgaatgacccaattggtcttaacaccaggaac 295  Q
    ||||||||| |||| ||  |||| ||||||||||||||  ||||| ||||||| ||  |||||| |||||||| ||||| ||| | ||||||||||||||    
8691229 ttaaaagtttaaacattgttgtaacaaaacaaacctggttatcatgaaaggtggcagaatgatattcatgaatcacccagttgcttttaacaccaggaac 8691130  T
296 a 296  Q
    |    
8691129 a 8691129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 40 - 123
Target Start/End: Complemental strand, 8722702 - 8722621
Alignment:
40 aaaatcaaattttcaaacaatgaatccaaacatcttcaaatttcagaacaacctatcagataagaaatatatcaaatcctgaaa 123  Q
    ||||||||| ||||||||||| |||||||  ||||||| |||||||||||||| ||  ||| ||||| ||||||||||||||||    
8722702 aaaatcaaaatttcaaacaataaatccaataatcttcatatttcagaacaaccaattggat-agaaa-atatcaaatcctgaaa 8722621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 342
Target Start/End: Complemental strand, 8722533 - 8722440
Alignment:
249 acatcatgatactcatgaatgacccaattggtcttaacaccaggaacaggattttcatggtaaacaagagtcttcttaatcccaataacttcat 342  Q
    |||||||| |||||| |||| ||||||||||| ||||||||||||  ||||      | |||||||||||| |||||  |||||||||||||||    
8722533 acatcatggtactcacgaataacccaattggttttaacaccaggatgaggagcaaggtagtaaacaagagttttcttcgtcccaataacttcat 8722440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 243
Target Start/End: Original strand, 7682 - 7746
Alignment:
179 gttacatattaaaagcattaaaagttaaaaccttaatgtagcaaaacaaacctggggatcatcaa 243  Q
    |||| |||||||||  ||||||| | |||||||||||||| |||||||||||| |||||||||||    
7682 gttatatattaaaataattaaaaatcaaaaccttaatgtaacaaaacaaacctagggatcatcaa 7746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137106 times since January 2019
Visitors: 1444