View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_26 (Length: 297)

Name: NF0931_high_26
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_26
NF0931_high_26
[»] chr8 (3 HSPs)
chr8 (1-290)||(1522218-1522507)
chr8 (1-241)||(1517855-1518095)
chr8 (21-289)||(1512672-1512940)
[»] chr1 (1 HSPs)
chr1 (1-243)||(16643526-16643768)


Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 1522218 - 1522507
Alignment:
1 aacaattggcatggacagtggttacagccctaaaatctttactatcttggcaaaatccactaaaatagagggtatccaagaaccttgccttgattcccaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1522218 aacaattggcatggacagtggttacagccctaaaatctttactatcttggcaaaatccactaaaatagagggtatccaagaaccttgccttgattcccaa 1522317  T
101 atctcgaaatataccacctttaatgaggtcctcaagcacatcttgctccnnnnnnnctgtgaaattatctttcattccataccatgtctcaaacaaagat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
1522318 atctcgaaatataccacctttaatgaggtcctcaagcacatcttgctcctttttttctgtgaaattatctttcattccataccatgtctcaaacaaagat 1522417  T
201 atggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgannnnnnnctgaccaaggatcaccaaagtattcgtctgtgctg 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
1522418 atggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgatttttttctgaccaaggatcaccaaagtattcgtctgtgctg 1522507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 1517855 - 1518095
Alignment:
1 aacaattggcatggacagtggttacagccctaaaatctttactatcttggcaaaatccactaaaatagagggtatccaagaaccttgccttgattcccaa 100  Q
    ||||||||||||| |||||||| ||  ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||  | || | ||||||    
1517855 aacaattggcatgaacagtggtcacttccctaaagtctttactatcttgacaaaatccactaaaatagagagtatccaagaacctaacatttagtcccaa 1517954  T
101 atctcgaaatataccacctttaatgaggtcctcaagcacatcttgctccnnnnnnnctgtgaaattatctttcattccataccatgtctcaaacaaagat 200  Q
    || || || ||||||||||  |||||||||   ||||||||||||||||       ||||| |||||||||||||||||| |||| | ||||||||||||    
1517955 atgtccaattataccacctccaatgaggtcaagaagcacatcttgctccttttttcctgtggaattatctttcattccattccatatttcaaacaaagat 1518054  T
201 atggtcttgttgtttgatctcacaaagaaaaatccagtatt 241  Q
    ||||||||||| || || ||| ||||| |||||||||||||    
1518055 atggtcttgttattcgacctcgcaaagtaaaatccagtatt 1518095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 21 - 289
Target Start/End: Original strand, 1512672 - 1512940
Alignment:
21 gttacagccctaaaatctttactatcttggcaaaatccactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctt 120  Q
    ||||| ||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||| ||  ||||||  || |||| || |||||||||| |||    
1512672 gttactgccctaacatctttactgtcttggcaaaatccactaaaataaagggtatccaagaatctaaccttgagccctaaatgtccaaatataccagctt 1512771  T
121 taatgaggtcctcaagcacatcttgctccnnnnnnnctgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatct 220  Q
     |||||||||   ||||||||||||||||       ||||| |||| |||||| ||||||||||||| |||||||| ||||||||||| || ||||| ||    
1512772 caatgaggtcaataagcacatcttgctcctttttacctgtggaattgtctttctttccataccatgtttcaaacaaggatatggtctttttatttgacct 1512871  T
221 cacaaagaaaaatccagtattgactcgannnnnnnctgaccaaggatcaccaaagtattcgtctgtgct 289  Q
    |||||||||||||||||||||||    |       |||||||||||||||||| |||| ||||||||||    
1512872 cacaaagaaaaatccagtattgatcaaatgtttttctgaccaaggatcaccaaggtatacgtctgtgct 1512940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 16643526 - 16643768
Alignment:
1 aacaattggcatggacagtggttacagccctaaaatctttactatcttggcaaaatccactaaaatagagggtatccaagaaccttgccttgattcccaa 100  Q
    ||||||||||||| |||||||| || ||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||  |||||| ||||||    
16643526 aacaattggcatgaacagtggtcactgccctaaaatctttactatcttgacaaaaaccactaaaatagagagtatccaagaacctaaccttgagtcccaa 16643625  T
101 atctcgaaatataccacctttaatgaggtcctcaagcacatcttgctccnnnnnnnctgtgaaattatctttcattccataccatgtctcaaacaaagat 200  Q
     | || || |||||||  | ||||||||||   ||| |||||||||||        ||||| |||| |||||| ||||||||||||| ||||||||||||    
16643626 gtgtccaattataccatgtctaatgaggtcaagaagaacatcttgctctttttttcctgtggaattgtctttctttccataccatgtttcaaacaaagat 16643725  T
201 atggtcttgttgtttgatctcacaaagaaaaatccagtattga 243  Q
    ||||||||||| || || || |||||| ||||||| |||||||    
16643726 atggtcttgttattggaccttacaaagtaaaatccggtattga 16643768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37933 times since January 2019
Visitors: 1598