View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_29 (Length: 277)

Name: NF0931_high_29
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_29
NF0931_high_29
[»] chr5 (1 HSPs)
chr5 (1-267)||(42285372-42285638)


Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 42285638 - 42285372
Alignment:
1 tatatattaaaagataccataattgatattttatatttttctcaatcaattgttcataaaaatataagagtagggtgttcaagtccttcaatatcaagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42285638 tatatattaaaagataccataattgatattttatatttttctcaatcaattgttcataaaaatataagagtagggtgttcaagtccttcaatatcaagat 42285539  T
101 tgagcttatttttatctactaatattaatttaggaggaagtttatttagatttatctgctgaggaaaatattttttatattagtgtttaggtattatttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42285538 tgagcttatttttatctactaatattaatttaggaggaagtttatttagatttatctgctgaggaaaatattttttatattagtgtttaggtattatttc 42285439  T
201 taaaatattttatgaaattcacgtnnnnnnntaataaacaaaagctggttctagggtgttctctctg 267  Q
    ||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
42285438 taaaatattttatgaaattcacgtaaaaaaataataaacaaaagctggttctagggtgttctctctg 42285372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 198771 times since January 2019
Visitors: 2774