View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_34 (Length: 251)

Name: NF0931_high_34
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_34
NF0931_high_34
[»] chr1 (1 HSPs)
chr1 (1-247)||(26456358-26456604)
[»] chr8 (1 HSPs)
chr8 (22-247)||(29675240-29675464)
[»] chr2 (1 HSPs)
chr2 (196-237)||(11494250-11494291)


Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 26456604 - 26456358
Alignment:
1 caggcaaataaaataacaactaaagttgtcacttattctagcatccctaacagttaagacttatcatggactctaatgtattttctcacggtaatattta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26456604 caggcaaataaaataacaactaaagttgtcacttattctagcatccctaacagttaagacttatcatggactctaatgtattttctcacggtaatattta 26456505  T
101 ccgagaagataaggggataaagtattgctattgatcacaataaacatgtataaagaataaagtaagaaaaattatagataaagagaatgaaagtgaaaac 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26456504 ccgagaagataaggggataaagtattgctactgatcacaataaacatgtataaagaataaagtaagaaaaattatagataaagagaatgaaagtgaaaac 26456405  T
201 aacctttgaatgcattaaagtcattagtttccgaatattattcgaca 247  Q
    ||||||||||||||||||||||||||||| ||||||||| |||||||    
26456404 aacctttgaatgcattaaagtcattagttcccgaatatttttcgaca 26456358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 22 - 247
Target Start/End: Complemental strand, 29675464 - 29675240
Alignment:
22 aaagttgtcacttattctagcatccctaacagttaagacttatcatggactctaatgtattttctcacggtaatatttaccgagaagataaggggataaa 121  Q
    |||| |||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||    
29675464 aaagctgtcacttatgctagcatccctaacagt-aagacctatcatggactctaatgtattttctcacggtaatattcaccgagaagattaggggattaa 29675366  T
122 gtattgctattgatcacaataaacatgtataaagaataaagtaagaaaaattatagataaagagaatgaaagtgaaaacaacctttgaatgcattaaagt 221  Q
     |||||| ||||| ||||||||||   | || ||||||||||||||||| || || |||||||| |||||||| |||||||||||||||| ||||| |||    
29675365 atattgccattgaacacaataaacgcatgtatagaataaagtaagaaaagttgtacataaagaggatgaaagtaaaaacaacctttgaattcattagagt 29675266  T
222 cattagtttccgaatattattcgaca 247  Q
    |||||||| ||||||||| |||||||    
29675265 cattagttcccgaatatttttcgaca 29675240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 11494250 - 11494291
Alignment:
196 aaaacaacctttgaatgcattaaagtcattagtttccgaata 237  Q
    |||||||||||||||||||||| ||||||||||| |||||||    
11494250 aaaacaacctttgaatgcattagagtcattagttcccgaata 11494291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 318476 times since January 2019
Visitors: 3039