View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_36 (Length: 251)

Name: NF0931_high_36
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_36
NF0931_high_36
[»] chr1 (2 HSPs)
chr1 (11-248)||(6317168-6317405)
chr1 (172-219)||(6297523-6297570)


Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 6317168 - 6317405
Alignment:
11 acaatatctaagtctcagtaagagtattattattcattaatcattaccttgctcgaatatacttggaaaatcagtcaaagtaaaatgtaaagcttgagtt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6317168 acaatatctaagtctcagtaagagtattattattcattaatcattaccttgctcgaatatacttggaaaatcagtcaaagtaaaatgtaaagcttgagtt 6317267  T
111 tcacattaccctgctagtcaaagtaaaagcagtcattgtataaagaataaaaaagtcacataccagctcagttcagactacttcatcagaagtgtccttt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
6317268 tcacattaccctgctagtcaaagtaaaagcagtcattgtataaagaataaaaaagccgcataccagctcagttcagactacttcatcagaagtgtccttt 6317367  T
211 actatagaagtctgttaaagcaagtaatagcaaattac 248  Q
    ||||||||||||||||||||||||||||||||||||||    
6317368 actatagaagtctgttaaagcaagtaatagcaaattac 6317405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 219
Target Start/End: Original strand, 6297523 - 6297570
Alignment:
172 accagctcagttcagactacttcatcagaagtgtcctttactatagaa 219  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||    
6297523 accagctctgttcagactacttcatcagaagtgtcctttactaaagaa 6297570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295297 times since January 2019
Visitors: 3016