View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_37 (Length: 251)

Name: NF0931_high_37
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_high_37
[»] chr5 (1 HSPs)
chr5 (1-239)||(11635256-11635495)
[»] chr6 (2 HSPs)
chr6 (177-234)||(5568994-5569051)
chr6 (177-234)||(5573975-5574032)

Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11635256 - 11635495
1 catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa 100  Q
11635256 catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa 11635355  T
101 tacatttcagatgaaggattttgcaaagctgtgagaaaac-tttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag 199  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11635356 tacatttcagatgaaggattttgcaaagctgtgagaaaacttttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag 11635455  T
200 tccttggccgatcttgccgtctttttaaatctctcatatt 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
11635456 tccttggccgatcttgccgtcttttaaaatctctcatatt 11635495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5569051 - 5568994
177 cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc 234  Q
    |||||| ||||| |||||||||||||| ||||||||||||| |  ||| |||||||||    
5569051 cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc 5568994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5574032 - 5573975
177 cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc 234  Q
    |||||| ||||| |||||||||||||| ||||||||||||| |  ||| |||||||||    
5574032 cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc 5573975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 176075 times since January 2019
Visitors: 2680