View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_40 (Length: 247)

Name: NF0931_high_40
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_40
NF0931_high_40
[»] chr7 (1 HSPs)
chr7 (11-247)||(24619646-24619882)
[»] chr8 (2 HSPs)
chr8 (67-169)||(2954371-2954473)
chr8 (99-169)||(5981621-5981690)
[»] chr3 (1 HSPs)
chr3 (99-144)||(40195999-40196044)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 24619646 - 24619882
Alignment:
11 acaatatctcctttaagtgtgagtcactcacgtatcctagttgatatgagacttaacactcacacttgaacttcaacaatctttgacacaagtgtgagtc 110  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24619646 acaatatccccttcaagtgtgagtcactcacgtatcctagttgatatgagacttaacactcacacttgaacttcaacaatctttggcacaagtgtgagtc 24619745  T
111 acccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagcctagacatccatgatcattaaaaaactttaagatattaagtatg 210  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||| ||||||| | |||||||||||||||||||||| |||||||| |||||||||||    
24619746 acccacatcactaacttgatccacactatgatcctggctccactcttccaccgatcttagacatccatgatcattaaaagactttaaggtattaagtatg 24619845  T
211 tgtgtcgcctctcaacatatcctcattcctaatcaat 247  Q
    |||||||||||||||||| ||||||||||||||||||    
24619846 tgtgtcgcctctcaacatgtcctcattcctaatcaat 24619882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 67 - 169
Target Start/End: Original strand, 2954371 - 2954473
Alignment:
67 cactcacacttgaacttcaacaatctttgacacaagtgtgagtcacccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagc 166  Q
    ||||||||||||||  ||||||||||    | ||||||||||||||||||||||| | |||||||||||||| |||| ||  ||||||| ||||||||||    
2954371 cactcacacttgaaactcaacaatctccccctcaagtgtgagtcacccacatcactagcttgatccacactaggatcttgctcccactcccccaccgagc 2954470  T
167 cta 169  Q
    |||    
2954471 cta 2954473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 5981621 - 5981690
Alignment:
99 caagtgtgagtcacccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagccta 169  Q
    |||| |||||||||||||||||| | | |||||||||||| ||||| |  ||||||| |||||||||||||    
5981621 caagcgtgagtcacccacatcactagcctgatccacactaggatcccgctcccactc-cccaccgagccta 5981690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 40195999 - 40196044
Alignment:
99 caagtgtgagtcacccacatcaccaacttgatccacactatgatcc 144  Q
    ||||||||||||||||||||||| | | |||||||||||| |||||    
40195999 caagtgtgagtcacccacatcactagcctgatccacactaggatcc 40196044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175705 times since January 2019
Visitors: 2679