View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_40 (Length: 247)

Name: NF0931_high_40
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_high_40
[»] chr7 (1 HSPs)
chr7 (11-247)||(24619646-24619882)
[»] chr8 (2 HSPs)
chr8 (67-169)||(2954371-2954473)
chr8 (99-169)||(5981621-5981690)
[»] chr3 (1 HSPs)
chr3 (99-144)||(40195999-40196044)

Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 247
Target Start/End: Original strand, 24619646 - 24619882
11 acaatatctcctttaagtgtgagtcactcacgtatcctagttgatatgagacttaacactcacacttgaacttcaacaatctttgacacaagtgtgagtc 110  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24619646 acaatatccccttcaagtgtgagtcactcacgtatcctagttgatatgagacttaacactcacacttgaacttcaacaatctttggcacaagtgtgagtc 24619745  T
111 acccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagcctagacatccatgatcattaaaaaactttaagatattaagtatg 210  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||| ||||||| | |||||||||||||||||||||| |||||||| |||||||||||    
24619746 acccacatcactaacttgatccacactatgatcctggctccactcttccaccgatcttagacatccatgatcattaaaagactttaaggtattaagtatg 24619845  T
211 tgtgtcgcctctcaacatatcctcattcctaatcaat 247  Q
    |||||||||||||||||| ||||||||||||||||||    
24619846 tgtgtcgcctctcaacatgtcctcattcctaatcaat 24619882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 67 - 169
Target Start/End: Original strand, 2954371 - 2954473
67 cactcacacttgaacttcaacaatctttgacacaagtgtgagtcacccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagc 166  Q
    ||||||||||||||  ||||||||||    | ||||||||||||||||||||||| | |||||||||||||| |||| ||  ||||||| ||||||||||    
2954371 cactcacacttgaaactcaacaatctccccctcaagtgtgagtcacccacatcactagcttgatccacactaggatcttgctcccactcccccaccgagc 2954470  T
167 cta 169  Q
2954471 cta 2954473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 5981621 - 5981690
99 caagtgtgagtcacccacatcaccaacttgatccacactatgatcctggccccactctcccaccgagccta 169  Q
    |||| |||||||||||||||||| | | |||||||||||| ||||| |  ||||||| |||||||||||||    
5981621 caagcgtgagtcacccacatcactagcctgatccacactaggatcccgctcccactc-cccaccgagccta 5981690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 144
Target Start/End: Original strand, 40195999 - 40196044
99 caagtgtgagtcacccacatcaccaacttgatccacactatgatcc 144  Q
    ||||||||||||||||||||||| | | |||||||||||| |||||    
40195999 caagtgtgagtcacccacatcactagcctgatccacactaggatcc 40196044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 37771 times since January 2019
Visitors: 1597