View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_41 (Length: 245)

Name: NF0931_high_41
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_high_41
[»] chr3 (1 HSPs)
chr3 (11-245)||(52477516-52477748)

Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 52477516 - 52477748
11 cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtca 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||    
52477516 cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcag--tca 52477613  T
111 aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc 210  Q
52477614 aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc 52477713  T
211 agtgtctctcctatgaagggtaatcctcgatttcc 245  Q
52477714 agtgtctctcctatgaagggtaatcctcgatttcc 52477748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191855 times since January 2019
Visitors: 2831