View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_42 (Length: 244)

Name: NF0931_high_42
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_42
NF0931_high_42
[»] chr8 (3 HSPs)
chr8 (1-232)||(1522275-1522506)
chr8 (1-186)||(1512709-1512894)
chr8 (1-184)||(1517912-1518095)
[»] chr1 (1 HSPs)
chr1 (1-186)||(16643583-16643768)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 1522275 - 1522506
Alignment:
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||        |    
1522275 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcttgctcctttttttc 1522374  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgannnnnnnct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
1522375 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgatttttttct 1522474  T
201 gaccaaggatcaccaaagtattcgtctctgct 232  Q
    ||||||||||||||||||||||||||| ||||    
1522475 gaccaaggatcaccaaagtattcgtctgtgct 1522506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 1512709 - 1512894
Alignment:
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    |||||||||| |||||||||||||| ||  ||||||  || |||| || |||||||||| ||| |||||||||   ||||||||| |||||        |    
1512709 cactaaaataaagggtatccaagaatctaaccttgagccctaaatgtccaaatataccagcttcaatgaggtcaataagcacatcttgctcctttttacc 1512808  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattga 186  Q
    |||| |||| |||||| ||||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||||||||||||||    
1512809 tgtggaattgtctttctttccataccatgtttcaaacaaggatatggtctttttatttgacctcacaaagaaaaatccagtattga 1512894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 1517912 - 1518095
Alignment:
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||| ||||||||||||||  | || | |||||||| || || ||||||||||  |||||||||   ||||||||| |||||        |    
1517912 cactaaaatagagagtatccaagaacctaacatttagtcccaaatgtccaattataccacctccaatgaggtcaagaagcacatcttgctccttttttcc 1518011  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtatt 184  Q
    |||| |||||||||||||||||| |||| | ||||||||||||||||||||||| || || ||| ||||| |||||||||||||    
1518012 tgtggaattatctttcattccattccatatttcaaacaaagatatggtcttgttattcgacctcgcaaagtaaaatccagtatt 1518095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 16643583 - 16643768
Alignment:
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||| ||||||||||||||  |||||| |||||| | || || |||||||  | ||||||||||   ||| ||||| |||||        |    
16643583 cactaaaatagagagtatccaagaacctaaccttgagtcccaagtgtccaattataccatgtctaatgaggtcaagaagaacatcttgctctttttttcc 16643682  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattga 186  Q
    |||| |||| |||||| ||||||||||||| ||||||||||||||||||||||| || || || |||||| ||||||| |||||||    
16643683 tgtggaattgtctttctttccataccatgtttcaaacaaagatatggtcttgttattggaccttacaaagtaaaatccggtattga 16643768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175444 times since January 2019
Visitors: 2677