View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_46 (Length: 228)

Name: NF0931_high_46
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_46
NF0931_high_46
[»] chr8 (2 HSPs)
chr8 (6-228)||(14224762-14224984)
chr8 (135-225)||(14232103-14232194)


Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 14224762 - 14224984
Alignment:
6 acacagttgttcactatacattttaaaaagcgacaactgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt 105  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14224762 acacagttgttcactatacattttaaaaagcgacagctgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt 14224861  T
106 atcacatgtcttccctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa 205  Q
    ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14224862 atcccatgtcttgcctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa 14224961  T
206 atttagttaacttctttaccttt 228  Q
    |||||||||||||||||||||||    
14224962 atttagttaacttctttaccttt 14224984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 14232103 - 14232194
Alignment:
135 tgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttgg-aaatttagttaacttctttacc 225  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||||    
14232103 tgagaatatcggtgatttccttttgattcaaattgaatatcctctaaaaataaaagagaatttatttggaaaatttagttaacttctttacc 14232194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 318565 times since January 2019
Visitors: 3039