View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_46 (Length: 228)

Name: NF0931_high_46
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_high_46
[»] chr8 (2 HSPs)
chr8 (6-228)||(14224762-14224984)
chr8 (135-225)||(14232103-14232194)

Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 14224762 - 14224984
6 acacagttgttcactatacattttaaaaagcgacaactgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt 105  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14224762 acacagttgttcactatacattttaaaaagcgacagctgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt 14224861  T
106 atcacatgtcttccctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa 205  Q
    ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14224862 atcccatgtcttgcctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa 14224961  T
206 atttagttaacttctttaccttt 228  Q
14224962 atttagttaacttctttaccttt 14224984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 14232103 - 14232194
135 tgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttgg-aaatttagttaacttctttacc 225  Q
    ||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||||    
14232103 tgagaatatcggtgatttccttttgattcaaattgaatatcctctaaaaataaaagagaatttatttggaaaatttagttaacttctttacc 14232194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125339 times since January 2019
Visitors: 1457