View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_21 (Length: 375)

Name: NF0931_low_21
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_21
NF0931_low_21
[»] chr1 (1 HSPs)
chr1 (6-346)||(4309466-4309809)


Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 6 - 346
Target Start/End: Original strand, 4309466 - 4309809
Alignment:
6 ctccaataatatagttgaaattaagaaaataaatacaaatatagtgactttagttaggtttagtctcaagcatnnnnnnnttaaaccaaagcatgtgttt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||       |||||||||||||| |||||    
4309466 ctccaataatatagttgaaattaagaaaataaatacaaatataatgactttagttaggtttagtctcgagcataaaaaaattaaaccaaagcatatgttt 4309565  T
106 atttttac---ggtggccacaaacatgcgttattttaaagctacaggaaggtagcttctacattaacgtaatttgaaacgcgaaaacaaacaagctacac 202  Q
    |||||||    ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||    
4309566 atttttatagtggtggccacaaacatgcgttattttaaagctacagtaagatagcttctacattaacgtaatttgaaacgcgaaaacaaacaagctacac 4309665  T
203 gctgttaaacgagtatcttggagacactttttaccatttctcttctctaagaaaacaatagaccacactattacaatttgtgcacgaacagacgtgggat 302  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||    
4309666 gctgttaaacgagtattttggagacactttttaccatttctcttctctaggaaaacaatagaccacactattacaatttgtgcatgaacagacgtgggat 4309765  T
303 gatagaaatattggtcaatgaatccgatggtaaatattaaaagc 346  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
4309766 gatagaaatattggtcaatgaatccgatggtaaatattaaaagc 4309809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125303 times since January 2019
Visitors: 1457