View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_21 (Length: 375)

Name: NF0931_low_21
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_21
[»] chr1 (1 HSPs)
chr1 (6-346)||(4309466-4309809)

Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 6 - 346
Target Start/End: Original strand, 4309466 - 4309809
6 ctccaataatatagttgaaattaagaaaataaatacaaatatagtgactttagttaggtttagtctcaagcatnnnnnnnttaaaccaaagcatgtgttt 105  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||       |||||||||||||| |||||    
4309466 ctccaataatatagttgaaattaagaaaataaatacaaatataatgactttagttaggtttagtctcgagcataaaaaaattaaaccaaagcatatgttt 4309565  T
106 atttttac---ggtggccacaaacatgcgttattttaaagctacaggaaggtagcttctacattaacgtaatttgaaacgcgaaaacaaacaagctacac 202  Q
    |||||||    ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||    
4309566 atttttatagtggtggccacaaacatgcgttattttaaagctacagtaagatagcttctacattaacgtaatttgaaacgcgaaaacaaacaagctacac 4309665  T
203 gctgttaaacgagtatcttggagacactttttaccatttctcttctctaagaaaacaatagaccacactattacaatttgtgcacgaacagacgtgggat 302  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||    
4309666 gctgttaaacgagtattttggagacactttttaccatttctcttctctaggaaaacaatagaccacactattacaatttgtgcatgaacagacgtgggat 4309765  T
303 gatagaaatattggtcaatgaatccgatggtaaatattaaaagc 346  Q
4309766 gatagaaatattggtcaatgaatccgatggtaaatattaaaagc 4309809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318482 times since January 2019
Visitors: 3039