View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_37 (Length: 302)

Name: NF0931_low_37
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_37
NF0931_low_37
[»] chr6 (7 HSPs)
chr6 (5-302)||(34383521-34383818)
chr6 (5-80)||(28982526-28982601)
chr6 (13-78)||(10729690-10729755)
chr6 (5-81)||(2204287-2204363)
chr6 (5-73)||(5456742-5456810)
chr6 (38-74)||(354415-354451)
chr6 (150-186)||(6577114-6577150)
[»] chr3 (13 HSPs)
chr3 (5-82)||(31350489-31350566)
chr3 (18-81)||(31664731-31664794)
chr3 (18-81)||(31930919-31930982)
chr3 (19-82)||(37143226-37143289)
chr3 (31-77)||(49875930-49875976)
chr3 (18-78)||(46114248-46114308)
chr3 (5-83)||(15927477-15927555)
chr3 (7-74)||(33976285-33976352)
chr3 (44-77)||(4617826-4617859)
chr3 (5-78)||(31425641-31425714)
chr3 (20-77)||(50886520-50886577)
chr3 (13-81)||(41610434-41610502)
chr3 (19-79)||(50886315-50886375)
[»] chr7 (5 HSPs)
chr7 (5-77)||(2819364-2819436)
chr7 (19-75)||(12651212-12651268)
chr7 (34-81)||(2069398-2069445)
chr7 (31-77)||(11778715-11778761)
chr7 (29-78)||(48591151-48591200)
[»] chr4 (4 HSPs)
chr4 (20-79)||(54128172-54128231)
chr4 (30-78)||(4272455-4272503)
chr4 (22-79)||(23719407-23719464)
chr4 (5-79)||(3698424-3698498)
[»] chr8 (6 HSPs)
chr8 (13-78)||(44952746-44952811)
chr8 (31-88)||(7612085-7612143)
chr8 (20-74)||(12171981-12172035)
chr8 (20-74)||(12416409-12416463)
chr8 (30-82)||(12946511-12946563)
chr8 (5-74)||(40649575-40649645)
[»] chr5 (8 HSPs)
chr5 (19-80)||(25603553-25603614)
chr5 (19-79)||(26009128-26009187)
chr5 (20-78)||(29499664-29499722)
chr5 (24-81)||(13739566-13739623)
chr5 (19-76)||(16967367-16967424)
chr5 (30-79)||(16967501-16967549)
chr5 (5-84)||(16594260-16594336)
chr5 (20-73)||(21575637-21575690)
[»] chr1 (10 HSPs)
chr1 (19-80)||(49660092-49660153)
chr1 (24-78)||(38762203-38762257)
chr1 (20-77)||(5466223-5466280)
chr1 (13-78)||(46859549-46859614)
chr1 (30-81)||(4604747-4604798)
chr1 (38-77)||(27260739-27260778)
chr1 (31-79)||(27260595-27260643)
chr1 (5-69)||(36775216-36775280)
chr1 (30-74)||(38289700-38289744)
chr1 (30-74)||(48872590-48872634)
[»] scaffold0481 (1 HSPs)
scaffold0481 (20-77)||(1089-1146)
[»] chr2 (2 HSPs)
chr2 (40-88)||(4969410-4969459)
chr2 (39-78)||(41317342-41317381)


Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 7)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 5 - 302
Target Start/End: Complemental strand, 34383818 - 34383521
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttttattattaatgatnnnnnnnnntt 104  Q
    ||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||    
34383818 tgtccaataaaaagagaggaaaagggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttttattattaatgataaaaaaaaatt 34383719  T
105 gtactttgttaaatgacaaaactagccccttaagttggcaaagaagataatcgaatttgagactttcgagagaagcatactctaaggtttcatgccaaca 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34383718 gtactttgttaaatgacaaaactagccccttaagttggcaaagaagataatcgaatttgagactttcgagagaagcatactctaaggtttcatgccaaca 34383619  T
205 tctccggaccaacgttagtaacttttttcaatggtaaatgttaattgttaatttgttatattagtttttacaccattaatactagagctaggagtagt 302  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||    
34383618 tcttcggaccaacgttagtaacttttttcaatggtaaatgttaattgttaatttgttagattagtttttacaccattaaaactagagctaggagtagt 34383521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 5 - 80
Target Start/End: Complemental strand, 28982601 - 28982526
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttt 80  Q
    ||||||| |||| |||||||||| ||||||||||||||||||||  ||||||| ||||||||||||||| ||||||    
28982601 tgtccaataaaaagagaggaaaaaggttgtcactaaaagttgttgaaaattggttgtcaaaatatcattactcttt 28982526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 10729690 - 10729755
Alignment:
13 aaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||| |||||||||| |||||||||||||||||||| |||||||| ||||||||||||||| ||||    
10729690 aaaaagagaggaaaaaggttgtcactaaaagttgttggaaattggttgtcaaaatatcattactct 10729755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 2204363 - 2204287
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    ||||||| |||| |||||||||| |||||||||||||||||||| |||||||  | | ||||||||| |||||||||    
2204363 tgtccaataaaaagagaggaaaaaggttgtcactaaaagttgttggaaattgattattaaaatatcactcctctttt 2204287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 5456810 - 5456742
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcatt 73  Q
    ||||||| |||| ||| | ||||  ||| ||||||||||||||| |||||||| |||||||||||||||    
5456810 tgtccaataaaaagagcgaaaaaatgttatcactaaaagttgttggaaattggttgtcaaaatatcatt 5456742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 74
Target Start/End: Original strand, 354415 - 354451
Alignment:
38 taaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    ||||||||||| |||||||| ||||||||||||||||    
354415 taaaagttgttggaaattggttgtcaaaatatcattc 354451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 186
Target Start/End: Complemental strand, 6577150 - 6577114
Alignment:
150 gataatcgaatttgagactttcgagagaagcatactc 186  Q
    |||||||||||||||||||||||||| ||||| ||||    
6577150 gataatcgaatttgagactttcgagaaaagcacactc 6577114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 31350566 - 31350489
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttta 82  Q
    ||||||| |||| ||||| ||||  ||||||||||||||||||| |||||||| ||||||||||||||||||||||||    
31350566 tgtccaataaaaagagagaaaaaaagttgtcactaaaagttgttggaaattggttgtcaaaatatcattcctctttta 31350489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 31664731 - 31664794
Alignment:
18 gagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||| |||||||    
31664731 gagaggaaaaaggttatcactaaaagttgttggaaattggttgtcaaaatatcattactctttt 31664794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 31930982 - 31930919
Alignment:
18 gagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||||||||| |||| ||||||||| ||||| |||||||| ||||||||||||||| |||||||    
31930982 gagaggaaaaaggttatcactaaaatttgttggaaattggttgtcaaaatatcattactctttt 31930919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 37143226 - 37143289
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttta 82  Q
    ||||||||| |||||||||||||||||||| |||||| | ||||||||||||||| ||| ||||    
37143226 agaggaaaaaggttgtcactaaaagttgttggaaattagttgtcaaaatatcattactcgttta 37143289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 49875930 - 49875976
Alignment:
31 ttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    |||||||||||||||||| |||||||| |||||||||||||||||||    
49875930 ttgtcactaaaagttgttggaaattggttgtcaaaatatcattcctc 49875976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 46114308 - 46114248
Alignment:
18 gagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||||||||| ||||||||| |||||||||| |||||||  ||||||||||||| ||||||    
46114308 gagaggaaaaaggttgtcaccaaaagttgttggaaattgattgtcaaaatatcagtcctct 46114248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 15927555 - 15927477
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttttat 83  Q
    ||||||| |||| ||| | ||||  ||||||||||||| || || |||||||| ||||||||||||||| |||||||||    
15927555 tgtccaataaaaagagcgaaaaaaagttgtcactaaaaattattggaaattggttgtcaaaatatcattactcttttat 15927477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 33976352 - 33976285
Alignment:
7 tccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    ||||| |||| ||||||||||  ||||||||||||| |||||  |||||  |||||||||||||||||    
33976352 tccaataaaaagagaggaaaagtgttgtcactaaaaattgttgaaaattaaatgtcaaaatatcattc 33976285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 77
Target Start/End: Original strand, 4617826 - 4617859
Alignment:
44 ttgttagaaattggatgtcaaaatatcattcctc 77  Q
    ||||| ||||||||||||||||||||||||||||    
4617826 ttgtttgaaattggatgtcaaaatatcattcctc 4617859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 31425641 - 31425714
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    ||||||| |||| |||||||||| |||||||| ||||| || ||  ||||| | ||||||||||||||| ||||    
31425641 tgtccaataaaaagagaggaaaaaggttgtcattaaaaattattgaaaattagttgtcaaaatatcattactct 31425714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 50886520 - 50886577
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    |||||||| |||||||||  ||||||||   ||||||| |||||||||||||||||||    
50886520 gaggaaaaaggttgtcacccaaagttgtctaaaattggttgtcaaaatatcattcctc 50886577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 41610434 - 41610502
Alignment:
13 aaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||| ||||| ||||  |||||||||| ||||||||  ||||| |  ||||||||||||||||||||||    
41610434 aaaaagagagaaaaaatgttgtcactagaagttgtttaaaatttgtagtcaaaatatcattcctctttt 41610502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 50886315 - 50886375
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    |||||||||  ||||||||| |||||||||  ||||||  ||||||||||||||| |||||    
50886315 agaggaaaaacgttgtcactgaaagttgttgaaaattgattgtcaaaatatcattactctt 50886375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 2819364 - 2819436
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    ||||||| |||| |||||||||| |||||||||||||| |||||  ||||||| |||||||||||||||||||    
2819364 tgtccaataaaaagagaggaaaaaggttgtcactaaaaattgttgaaaattggttgtcaaaatatcattcctc 2819436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 12651268 - 12651212
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcc 75  Q
    |||||||||  |||||||| |||||||||| |||||||| |||||||||||||||||    
12651268 agaggaaaaaagttgtcaccaaaagttgttggaaattggttgtcaaaatatcattcc 12651212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 2069445 - 2069398
Alignment:
34 tcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||| ||||||||||  ||||||| |||||||||||||||||||||||    
2069445 tcacaaaaagttgtttaaaattggttgtcaaaatatcattcctctttt 2069398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 11778715 - 11778761
Alignment:
31 ttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    ||||| ||||||||||||  ||||||| |||||||||||||||||||    
11778715 ttgtccctaaaagttgtttaaaattggttgtcaaaatatcattcctc 11778761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 48591200 - 48591151
Alignment:
29 ggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||||||||  ||||||||| |||||||| ||||||||||||||| ||||    
48591200 ggttgtcacccaaagttgttggaaattggttgtcaaaatatcattactct 48591151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 54128172 - 54128231
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    |||||||| ||||||||||||||||||||  ||||||| |||||||||||||||||||||    
54128172 gaggaaaaaggttgtcactaaaagttgtttaaaattggttgtcaaaatatcattcctctt 54128231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 4272503 - 4272455
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||||    
4272503 gttgtcactaaaagttgttggaaattggttgtcaaaatatcattcctct 4272455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 23719464 - 23719407
Alignment:
22 ggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    |||||| |||||||| | |||||||||  ||||||| |||||||||||||||||||||    
23719464 ggaaaaaggttgtcattcaaagttgtttcaaattggttgtcaaaatatcattcctctt 23719407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 79
Target Start/End: Original strand, 3698424 - 3698498
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    ||||||| |||| ||||||||||  ||||||||||||| ||||| |||||| | | |  ||||||||||||||||    
3698424 tgtccaataaaaagagaggaaaaaagttgtcactaaaaattgttggaaattagttatgcaaatatcattcctctt 3698498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 44952746 - 44952811
Alignment:
13 aaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||| ||||| |||| | |||||||||||| |||||||||||||  ||||||||||||||||||||    
44952746 aaaaagagagaaaaaagattgtcactaaaaattgttagaaattgattgtcaaaatatcattcctct 44952811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 7612143 - 7612085
Alignment:
31 ttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt-ttattatta 88  Q
    ||||| ||||||||||||  ||||||| ||||||||||||||||||||| |||||||||    
7612143 ttgtccctaaaagttgtttaaaattggttgtcaaaatatcattcctcttattattatta 7612085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 74
Target Start/End: Complemental strand, 12172035 - 12171981
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    |||||||| |||||||||||||| |||||  ||||||| ||||||||||||||||    
12172035 gaggaaaaaggttgtcactaaaatttgtttaaaattggttgtcaaaatatcattc 12171981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 74
Target Start/End: Complemental strand, 12416463 - 12416409
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    |||||||| |||||||||||||| |||||  ||||||| ||||||||||||||||    
12416463 gaggaaaaaggttgtcactaaaatttgtttaaaattggttgtcaaaatatcattc 12416409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 12946563 - 12946511
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttta 82  Q
    |||||| | ||||||||||  |||||||||||||||||||||||| |||||||    
12946563 gttgtcccaaaaagttgttgaaaattggatgtcaaaatatcattcatctttta 12946511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 74
Target Start/End: Original strand, 40649575 - 40649645
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtc-aaaatatcattc 74  Q
    ||||||| ||||  ||||||||| |||||||||||||| |||||  ||||||| |||| ||||||||||||    
40649575 tgtccaataaaaatagaggaaaaaggttgtcactaaaaattgttgaaaattggttgtcaaaaatatcattc 40649645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 25603614 - 25603553
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttt 80  Q
    |||||||||  ||| ||||||||| |||||||||||||| |||||||||||||||| |||||    
25603614 agaggaaaaatgttatcactaaaaattgttagaaattggttgtcaaaatatcattcatcttt 25603553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 26009187 - 26009128
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    ||||||||| ||||||||||||||||||||  ||||||  |||||||||||||||||||||    
26009187 agaggaaaa-ggttgtcactaaaagttgtttaaaattgattgtcaaaatatcattcctctt 26009128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 29499722 - 29499664
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||||||| | || || |||||| |||||| ||||||||||||||||||||||||||||    
29499722 gaggaaaaagattatccctaaaaattgttaaaaattggatgtcaaaatatcattcctct 29499664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 81
Target Start/End: Original strand, 13739566 - 13739623
Alignment:
24 aaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||| ||||||| ||||||||||||  || |||| |||||||||||||||||||||||    
13739566 aaaaaggttgtccctaaaagttgtttaaagttggttgtcaaaatatcattcctctttt 13739623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 16967424 - 16967367
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcct 76  Q
    |||||||||  |||||| ||||||||||||  ||||| ||||||||||||||||||||    
16967424 agaggaaaaatgttgtccctaaaagttgttgaaaattagatgtcaaaatatcattcct 16967367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 16967501 - 16967549
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    |||||||| ||||||||||  |||||||||||||||||||||||||||||    
16967501 gttgtcac-aaaagttgttgaaaattggatgtcaaaatatcattcctctt 16967549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 84
Target Start/End: Complemental strand, 16594336 - 16594260
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttttatt 84  Q
    ||||||| |||| |||||||||   ||||||||||||| |||   |||||||| |||||||||||||||| ||| |||||    
16594336 tgtccaataaaaagagaggaaataagttgtcactaaaaattg---gaaattggttgtcaaaatatcattcttctattatt 16594260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 21575690 - 21575637
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcatt 73  Q
    ||||||||  |||||||||||| ||||||  ||||||| |||||||||||||||    
21575690 gaggaaaaatgttgtcactaaatgttgtttaaaattggttgtcaaaatatcatt 21575637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 49660092 - 49660153
Alignment:
19 agaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctcttt 80  Q
    |||||||||  ||||||||  ||||||||| | |||||||||||||||||||||||||||||    
49660092 agaggaaaaaagttgtcacccaaagttgtttggaattggatgtcaaaatatcattcctcttt 49660153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 78
Target Start/End: Complemental strand, 38762257 - 38762203
Alignment:
24 aaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||| ||||||| ||||||||||||  ||||||| ||||||||||||||||||||    
38762257 aaaaaggttgtccctaaaagttgtttaaaattggttgtcaaaatatcattcctct 38762203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 77
Target Start/End: Complemental strand, 5466280 - 5466223
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    |||||||| |||||||||  |||||||||  ||||||| |||||||||||||||||||    
5466280 gaggaaaaaggttgtcacccaaagttgtttaaaattggttgtcaaaatatcattcctc 5466223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 46859549 - 46859614
Alignment:
13 aaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    |||| |||||||||| |  ||||||||||||||||| |||||||| |||| |||||||||| ||||    
46859549 aaaaagagaggaaaaagactgtcactaaaagttgttggaaattggttgtctaaatatcattactct 46859614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 4604747 - 4604798
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctttt 81  Q
    |||||| ||||||||||||  ||||||| |||||||||||||||||| ||||    
4604747 gttgtccctaaaagttgttttaaattggttgtcaaaatatcattcctatttt 4604798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 38 - 77
Target Start/End: Original strand, 27260739 - 27260778
Alignment:
38 taaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    |||||||||||  |||||||||||||||||||||||||||    
27260739 taaaagttgttgaaaattggatgtcaaaatatcattcctc 27260778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 27260643 - 27260595
Alignment:
31 ttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctctt 79  Q
    ||||| |||||| |||||  ||||||||||||||||||||| |||||||    
27260643 ttgtctctaaaaattgttgaaaattggatgtcaaaatatcaatcctctt 27260595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 36775216 - 36775280
Alignment:
5 tgtccaagaaaatgagaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatat 69  Q
    ||||||| ||||  |||| |||| |||||||||  ||||||||| |||||||| |||||||||||    
36775216 tgtccaataaaaaaagagaaaaaaggttgtcacccaaagttgttggaaattggttgtcaaaatat 36775280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Original strand, 38289700 - 38289744
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    |||||| ||||||||||||  ||||| ||||||||||||||||||    
38289700 gttgtctctaaaagttgttgaaaatttgatgtcaaaatatcattc 38289744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 48872634 - 48872590
Alignment:
30 gttgtcactaaaagttgttagaaattggatgtcaaaatatcattc 74  Q
    |||||| ||| ||||||||  ||||||||||||||||||||||||    
48872634 gttgtctctataagttgttgaaaattggatgtcaaaatatcattc 48872590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 77
Target Start/End: Complemental strand, 1146 - 1089
Alignment:
20 gaggaaaatggttgtcactaaaagttgttagaaattggatgtcaaaatatcattcctc 77  Q
    |||||||| |||||||||  |||||||||  ||||||| |||||||||||||||||||    
1146 gaggaaaaaggttgtcacccaaagttgtttaaaattggttgtcaaaatatcattcctc 1089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 88
Target Start/End: Complemental strand, 4969459 - 4969410
Alignment:
40 aaagttgttagaaattggatgtcaaaatatcattcctctt-ttattatta 88  Q
    ||||||||| ||||||||||||||||||||||||| |||| |||||||||    
4969459 aaagttgtttgaaattggatgtcaaaatatcattcatcttattattatta 4969410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 39 - 78
Target Start/End: Original strand, 41317342 - 41317381
Alignment:
39 aaaagttgttagaaattggatgtcaaaatatcattcctct 78  Q
    ||||||||||  ||||||||||||||||||||||||||||    
41317342 aaaagttgttgaaaattggatgtcaaaatatcattcctct 41317381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 109781 times since January 2019
Visitors: 1349