View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_44 (Length: 277)

Name: NF0931_low_44
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_44
[»] chr5 (1 HSPs)
chr5 (1-267)||(42285372-42285638)

Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 42285638 - 42285372
1 tatatattaaaagataccataattgatattttatatttttctcaatcaattgttcataaaaatataagagtagggtgttcaagtccttcaatatcaagat 100  Q
42285638 tatatattaaaagataccataattgatattttatatttttctcaatcaattgttcataaaaatataagagtagggtgttcaagtccttcaatatcaagat 42285539  T
101 tgagcttatttttatctactaatattaatttaggaggaagtttatttagatttatctgctgaggaaaatattttttatattagtgtttaggtattatttc 200  Q
42285538 tgagcttatttttatctactaatattaatttaggaggaagtttatttagatttatctgctgaggaaaatattttttatattagtgtttaggtattatttc 42285439  T
201 taaaatattttatgaaattcacgtnnnnnnntaataaacaaaagctggttctagggtgttctctctg 267  Q
    ||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
42285438 taaaatattttatgaaattcacgtaaaaaaataataaacaaaagctggttctagggtgttctctctg 42285372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295872 times since January 2019
Visitors: 3016