View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_49 (Length: 258)

Name: NF0931_low_49
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_49
[»] chr4 (1 HSPs)
chr4 (1-247)||(2862140-2862386)
[»] chr1 (2 HSPs)
chr1 (129-240)||(1875682-1875793)
chr1 (129-240)||(1808078-1808189)

Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2862386 - 2862140
1 caatcccagcaaacaaaagcaacacccctaatatgccaataggaaactgacccaaaattcttccaaaagagttcccaaaaaccaaagcaatcaacaattt 100  Q
2862386 caatcccagcaaacaaaagcaacacccctaatatgccaataggaaactgacccaaaattcttccaaaagagttcccaaaaaccaaagcaatcaacaattt 2862287  T
101 accaaccccaagaaaaacaacagaagcaccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaac 200  Q
2862286 accaaccccaagaaaaacaacagaagcaccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaac 2862187  T
201 caacaaccaacaaaattcatcactccaacactcactgaaaccttcat 247  Q
2862186 caacaaccaacaaaattcatcactccaacactcactgaaaccttcat 2862140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 1875793 - 1875682
129 ccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaaccaacaaccaacaaaattcatcactccaa 228  Q
    |||||||| || |||||  ||||||| || || | ||||||||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||  ||||    
1875793 ccactccttccaccaaatttatactgtcctgctagtccaccagcaccatggcaagatggcattgcaccaaaccaacaaccaaccaaattcatcaacccaa 1875694  T
229 cactcactgaaa 240  Q
    |  |||||||||    
1875693 ctgtcactgaaa 1875682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 1808189 - 1808078
129 ccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaaccaacaaccaacaaaattcatcactccaa 228  Q
    |||||||| ||||||||  ||||||| || || | ||| ||||| ||||| |||   |||| ||||||||||||| ||||||| |||||||| | |||||    
1808189 ccactccttcctccaaatttatactgtcctgctagtcctccagcaccatgacaagttggcacagcaccaaaccaagaaccaactaaattcattagtccaa 1808090  T
229 cactcactgaaa 240  Q
    |  |||||||||    
1808089 ctgtcactgaaa 1808078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125077 times since January 2019
Visitors: 1422