View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_49 (Length: 258)

Name: NF0931_low_49
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_49
NF0931_low_49
[»] chr4 (1 HSPs)
chr4 (1-247)||(2862140-2862386)
[»] chr1 (2 HSPs)
chr1 (129-240)||(1875682-1875793)
chr1 (129-240)||(1808078-1808189)


Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2862386 - 2862140
Alignment:
1 caatcccagcaaacaaaagcaacacccctaatatgccaataggaaactgacccaaaattcttccaaaagagttcccaaaaaccaaagcaatcaacaattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2862386 caatcccagcaaacaaaagcaacacccctaatatgccaataggaaactgacccaaaattcttccaaaagagttcccaaaaaccaaagcaatcaacaattt 2862287  T
101 accaaccccaagaaaaacaacagaagcaccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2862286 accaaccccaagaaaaacaacagaagcaccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaac 2862187  T
201 caacaaccaacaaaattcatcactccaacactcactgaaaccttcat 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
2862186 caacaaccaacaaaattcatcactccaacactcactgaaaccttcat 2862140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 1875793 - 1875682
Alignment:
129 ccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaaccaacaaccaacaaaattcatcactccaa 228  Q
    |||||||| || |||||  ||||||| || || | ||||||||| ||||||||| | ||||| |||||||||||||||||||| ||||||||||  ||||    
1875793 ccactccttccaccaaatttatactgtcctgctagtccaccagcaccatggcaagatggcattgcaccaaaccaacaaccaaccaaattcatcaacccaa 1875694  T
229 cactcactgaaa 240  Q
    |  |||||||||    
1875693 ctgtcactgaaa 1875682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 1808189 - 1808078
Alignment:
129 ccactcctacctccaaacctatactgaccagccaatccaccagctccatggcaacaaggcatagcaccaaaccaacaaccaacaaaattcatcactccaa 228  Q
    |||||||| ||||||||  ||||||| || || | ||| ||||| ||||| |||   |||| ||||||||||||| ||||||| |||||||| | |||||    
1808189 ccactccttcctccaaatttatactgtcctgctagtcctccagcaccatgacaagttggcacagcaccaaaccaagaaccaactaaattcattagtccaa 1808090  T
229 cactcactgaaa 240  Q
    |  |||||||||    
1808089 ctgtcactgaaa 1808078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295257 times since January 2019
Visitors: 3016