View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_54 (Length: 251)

Name: NF0931_low_54
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_54
[»] chr1 (2 HSPs)
chr1 (11-248)||(6317168-6317405)
chr1 (172-219)||(6297523-6297570)

Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1

Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 6317168 - 6317405
11 acaatatctaagtctcagtaagagtattattattcattaatcattaccttgctcgaatatacttggaaaatcagtcaaagtaaaatgtaaagcttgagtt 110  Q
6317168 acaatatctaagtctcagtaagagtattattattcattaatcattaccttgctcgaatatacttggaaaatcagtcaaagtaaaatgtaaagcttgagtt 6317267  T
111 tcacattaccctgctagtcaaagtaaaagcagtcattgtataaagaataaaaaagtcacataccagctcagttcagactacttcatcagaagtgtccttt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
6317268 tcacattaccctgctagtcaaagtaaaagcagtcattgtataaagaataaaaaagccgcataccagctcagttcagactacttcatcagaagtgtccttt 6317367  T
211 actatagaagtctgttaaagcaagtaatagcaaattac 248  Q
6317368 actatagaagtctgttaaagcaagtaatagcaaattac 6317405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 219
Target Start/End: Original strand, 6297523 - 6297570
172 accagctcagttcagactacttcatcagaagtgtcctttactatagaa 219  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||    
6297523 accagctctgttcagactacttcatcagaagtgtcctttactaaagaa 6297570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 111476 times since January 2019
Visitors: 1375