View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_55 (Length: 251)

Name: NF0931_low_55
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_55
NF0931_low_55
[»] chr5 (1 HSPs)
chr5 (1-239)||(11635256-11635495)
[»] chr6 (2 HSPs)
chr6 (177-234)||(5568994-5569051)
chr6 (177-234)||(5573975-5574032)


Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 11635256 - 11635495
Alignment:
1 catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11635256 catccatgatttattttctaaatttttatgctgcttaatgatggctttatgcatttgcagtggcactaatctgagatgcatgcggcttgtagaatgccaa 11635355  T
101 tacatttcagatgaaggattttgcaaagctgtgagaaaac-tttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag 199  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11635356 tacatttcagatgaaggattttgcaaagctgtgagaaaacttttgcagttagaggagttagagatttcattatgtagcctatcgaaggagtctcttgaag 11635455  T
200 tccttggccgatcttgccgtctttttaaatctctcatatt 239  Q
    ||||||||||||||||||||||||| ||||||||||||||    
11635456 tccttggccgatcttgccgtcttttaaaatctctcatatt 11635495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5569051 - 5568994
Alignment:
177 cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc 234  Q
    |||||| ||||| |||||||||||||| ||||||||||||| |  ||| |||||||||    
5569051 cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc 5568994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 234
Target Start/End: Complemental strand, 5574032 - 5573975
Alignment:
177 cctatcgaaggagtctcttgaagtccttggccgatcttgccgtctttttaaatctctc 234  Q
    |||||| ||||| |||||||||||||| ||||||||||||| |  ||| |||||||||    
5574032 cctatcaaaggattctcttgaagtcctaggccgatcttgccctagtttaaaatctctc 5573975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191791 times since January 2019
Visitors: 2831