View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_57 (Length: 251)

Name: NF0931_low_57
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_57
[»] chr3 (1 HSPs)
chr3 (1-244)||(47508695-47508935)

Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 47508935 - 47508695
1 caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagaatgctgaatagatcttccggtattgctcatatctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
47508935 caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagattgctgaatagatcttccggtattgctcatatctt 47508836  T
101 gttatataattttttctcaaagaactgatcagaagttatcctccgatgaatgttttgagggnnnnnnngcagtaatgcagggggtttgtacaacaataat 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||       ||||||||||||||||||||||||||||||||    
47508835 gttatataattttttctcaaagaactgatcagaagttatcttccgatgagtgttttgaggggttttttgcagtaatgcagggggtttgtacaacaataat 47508736  T
201 ctaaattaataatcaagaagaggataaagtagtgattcatctca 244  Q
    ||||||||||| ||   ||||||||||||||||||||| |||||    
47508735 ctaaattaatactc---aagaggataaagtagtgattcttctca 47508695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175499 times since January 2019
Visitors: 2677