View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_57 (Length: 251)

Name: NF0931_low_57
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_57
NF0931_low_57
[»] chr3 (1 HSPs)
chr3 (1-244)||(47508695-47508935)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 47508935 - 47508695
Alignment:
1 caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagaatgctgaatagatcttccggtattgctcatatctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
47508935 caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagattgctgaatagatcttccggtattgctcatatctt 47508836  T
101 gttatataattttttctcaaagaactgatcagaagttatcctccgatgaatgttttgagggnnnnnnngcagtaatgcagggggtttgtacaacaataat 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||       ||||||||||||||||||||||||||||||||    
47508835 gttatataattttttctcaaagaactgatcagaagttatcttccgatgagtgttttgaggggttttttgcagtaatgcagggggtttgtacaacaataat 47508736  T
201 ctaaattaataatcaagaagaggataaagtagtgattcatctca 244  Q
    ||||||||||| ||   ||||||||||||||||||||| |||||    
47508735 ctaaattaatactc---aagaggataaagtagtgattcttctca 47508695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18450 times since January 2019
Visitors: 1569