View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_62 (Length: 245)

Name: NF0931_low_62
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_low_62
NF0931_low_62
[»] chr3 (1 HSPs)
chr3 (11-245)||(52477516-52477748)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 52477516 - 52477748
Alignment:
11 cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtca 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||    
52477516 cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcag--tca 52477613  T
111 aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52477614 aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc 52477713  T
211 agtgtctctcctatgaagggtaatcctcgatttcc 245  Q
    |||||||||||||||||||||||||||||||||||    
52477714 agtgtctctcctatgaagggtaatcctcgatttcc 52477748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295416 times since January 2019
Visitors: 3016