View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_low_63 (Length: 244)

Name: NF0931_low_63
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0931_low_63
[»] chr8 (3 HSPs)
chr8 (1-232)||(1522275-1522506)
chr8 (1-186)||(1512709-1512894)
chr8 (1-184)||(1517912-1518095)
[»] chr1 (1 HSPs)
chr1 (1-186)||(16643583-16643768)

Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 1522275 - 1522506
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||        |    
1522275 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcttgctcctttttttc 1522374  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgannnnnnnct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
1522375 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattgactcgatttttttct 1522474  T
201 gaccaaggatcaccaaagtattcgtctctgct 232  Q
    ||||||||||||||||||||||||||| ||||    
1522475 gaccaaggatcaccaaagtattcgtctgtgct 1522506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 1512709 - 1512894
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    |||||||||| |||||||||||||| ||  ||||||  || |||| || |||||||||| ||| |||||||||   ||||||||| |||||        |    
1512709 cactaaaataaagggtatccaagaatctaaccttgagccctaaatgtccaaatataccagcttcaatgaggtcaataagcacatcttgctcctttttacc 1512808  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattga 186  Q
    |||| |||| |||||| ||||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||||||||||||||    
1512809 tgtggaattgtctttctttccataccatgtttcaaacaaggatatggtctttttatttgacctcacaaagaaaaatccagtattga 1512894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 1517912 - 1518095
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||| ||||||||||||||  | || | |||||||| || || ||||||||||  |||||||||   ||||||||| |||||        |    
1517912 cactaaaatagagagtatccaagaacctaacatttagtcccaaatgtccaattataccacctccaatgaggtcaagaagcacatcttgctccttttttcc 1518011  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtatt 184  Q
    |||| |||||||||||||||||| |||| | ||||||||||||||||||||||| || || ||| ||||| |||||||||||||    
1518012 tgtggaattatctttcattccattccatatttcaaacaaagatatggtcttgttattcgacctcgcaaagtaaaatccagtatt 1518095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 16643583 - 16643768
1 cactaaaatagagggtatccaagaaccttgccttgattcccaaatctcgaaatataccacctttaatgaggtcctcaagcacatcgtgctcnnnnnnnnc 100  Q
    ||||||||||||| ||||||||||||||  |||||| |||||| | || || |||||||  | ||||||||||   ||| ||||| |||||        |    
16643583 cactaaaatagagagtatccaagaacctaaccttgagtcccaagtgtccaattataccatgtctaatgaggtcaagaagaacatcttgctctttttttcc 16643682  T
101 tgtgaaattatctttcattccataccatgtctcaaacaaagatatggtcttgttgtttgatctcacaaagaaaaatccagtattga 186  Q
    |||| |||| |||||| ||||||||||||| ||||||||||||||||||||||| || || || |||||| ||||||| |||||||    
16643683 tgtggaattgtctttctttccataccatgtttcaaacaaagatatggtcttgttattggaccttacaaagtaaaatccggtattga 16643768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 175414 times since January 2019
Visitors: 2677