View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_10 (Length: 496)

Name: NF0945_high_10
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_high_10
[»] chr4 (1 HSPs)
chr4 (13-467)||(33398956-33399410)

Alignment Details
Target: chr4 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 13 - 467
Target Start/End: Original strand, 33398956 - 33399410
13 aatatcaattaagcattaatgttacttttcttatattatactcttaactcttactatcttctttctgnnnnnnnnnnnnaatatatatttctcatgacat 112  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||             ||| |||||||||||||||||    
33398956 aatatcaattaagcattaatgttacttttcttatattatacttttaactcttactatcttctttctattatttttttttaatttatatttctcatgacat 33399055  T
113 aaatgaaggata-ttttataagataattcataatttctannnnnnnacacagaattaattacattgcttactttgtaccaaaactaatcaatatggctta 211  Q
    |||||||||||| |||||||| |||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33399056 aaatgaaggatagttttataaaataattcataatttctatttttt-acacagaattaattacattgcttactttgtaccaaaactaatcaatatggctta 33399154  T
212 taatttaagagggagagagtataagttagttttgaaaagtggattttcattaaatttacccccacagcacaagatgtgcataaatggagggaaataacat 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
33399155 taatttaagagggagagagtataagttagttttgaaaagtggattttcattaaatttactcccacagcacaagatgtgcataaatggagggaaataacat 33399254  T
312 cagtccacatgctttacacggtacaaatgtaaccaaacaaaacaacatatacccaaggctacattcattgtgaggtacatctgtgtaactaataagaacc 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||    
33399255 cagtccacatgctttacacggtacaaatgtaaccaaacaaaacaacatatacccaaggctacattcattgtaaagtacatctgtgtaactaataagaacc 33399354  T
412 atctaatgcataattatgcagaagatggttttcaattctgcaccaacacttgcatc 467  Q
33399355 atctaatgcataattatgcagaagatggttttcaattctgcaccaacacttgcatc 33399410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109799 times since January 2019
Visitors: 1349