View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0945_high_31 (Length: 326)

Name: NF0945_high_31
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0945_high_31
[»] chr3 (13 HSPs)
chr3 (1-295)||(50241389-50241664)
chr3 (159-285)||(2250895-2251020)
chr3 (159-285)||(14045308-14045434)
chr3 (159-285)||(20790232-20790357)
chr3 (159-285)||(39184079-39184205)
chr3 (159-285)||(40057690-40057816)
chr3 (165-202)||(20935037-20935074)
chr3 (165-202)||(32976511-32976548)
chr3 (165-202)||(42400423-42400460)
chr3 (171-202)||(50332005-50332036)
chr3 (102-134)||(14249271-14249303)
chr3 (170-202)||(17764130-17764162)
chr3 (170-202)||(19065450-19065482)
[»] chr4 (6 HSPs)
chr4 (1-294)||(6554451-6554725)
chr4 (1-294)||(314233-314507)
chr4 (170-285)||(35695942-35696059)
chr4 (171-202)||(13228701-13228732)
chr4 (93-137)||(24180967-24181011)
chr4 (22-70)||(35696136-35696184)
[»] scaffold0211 (1 HSPs)
scaffold0211 (1-294)||(18355-18629)
[»] scaffold0114 (1 HSPs)
scaffold0114 (1-290)||(36954-37224)
[»] chr5 (5 HSPs)
chr5 (1-294)||(9024862-9025136)
chr5 (159-285)||(30327039-30327164)
chr5 (159-286)||(23570626-23570752)
chr5 (171-202)||(38015979-38016010)
chr5 (204-285)||(27593551-27593632)
[»] chr8 (9 HSPs)
chr8 (13-293)||(41526946-41527205)
chr8 (159-285)||(360967-361092)
chr8 (165-285)||(40886775-40886896)
chr8 (159-285)||(45245232-45245358)
chr8 (167-202)||(38290543-38290578)
chr8 (147-197)||(17871244-17871294)
chr8 (171-201)||(42797332-42797362)
chr8 (171-199)||(13756548-13756576)
chr8 (152-199)||(14373895-14373940)
[»] chr2 (7 HSPs)
chr2 (1-294)||(31965745-31966017)
chr2 (165-202)||(19040706-19040743)
chr2 (165-202)||(39839128-39839165)
chr2 (170-202)||(36720075-36720107)
chr2 (150-201)||(14905103-14905154)
chr2 (204-285)||(24968967-24969048)
chr2 (92-137)||(45054785-45054830)
[»] chr1 (11 HSPs)
chr1 (1-293)||(49881712-49881987)
chr1 (159-285)||(19102761-19102886)
chr1 (230-294)||(45918340-45918404)
chr1 (159-285)||(21467720-21467845)
chr1 (165-202)||(1992431-1992468)
chr1 (165-202)||(20306773-20306810)
chr1 (165-202)||(40946528-40946565)
chr1 (165-202)||(30001782-30001819)
chr1 (170-202)||(43387145-43387177)
chr1 (173-202)||(3982731-3982760)
chr1 (173-201)||(47783156-47783184)
[»] scaffold0284 (1 HSPs)
scaffold0284 (1-285)||(731-996)
[»] chr6 (8 HSPs)
chr6 (159-285)||(21986190-21986315)
chr6 (159-285)||(33348201-33348326)
chr6 (165-202)||(7428525-7428562)
chr6 (165-201)||(16279120-16279156)
chr6 (165-201)||(28365735-28365771)
chr6 (171-202)||(1599691-1599722)
chr6 (175-220)||(9449661-9449706)
chr6 (147-212)||(16705606-16705671)
[»] scaffold1345 (1 HSPs)
scaffold1345 (165-202)||(1857-1894)
[»] chr7 (2 HSPs)
chr7 (165-202)||(43989691-43989728)
chr7 (92-132)||(6198481-6198521)
[»] scaffold1750 (1 HSPs)
scaffold1750 (165-202)||(324-361)

Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 13)
Name: chr3

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 50241664 - 50241389
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||| ||||| |||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| |||    
50241664 ttacagtgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaactttaagccagtagtatgtatatg 50241565  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    |||||||||||||||||||||||||||||                   |||||||||||||||||||| ||||||||||||||||||||||||||||||     
50241564 agtcatctcacttatatgttattcataat-------------------ttactcttatatccactatagaattttaactcacacttgacacattaacatt 50241484  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggttaa 295  Q
    |  ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
50241483 ttttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggttaa 50241389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 2251020 - 2250895
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||||||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
2251020 atccaatataaatttttaactcatacttgacacattaacatctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 2250922  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||| | || |||||||||||||    
2250921 caaaggaaaatacaatatgtttaaaaa 2250895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 14045434 - 14045308
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| ||||||||||||||||||||| |||||||||||| ||| ||||||| ||||||| ||||| ||| ||||||||||||| |||||| ||||  ||    
14045434 atccaatataaaattttaactcacactcgacacattaacacctcttattcaaatttgcaagtctctgtgtccataattacgtgatatagtcaaatatgat 14045335  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
14045334 caaaggaagatacaatatgtttaaaaa 14045308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 20790357 - 20790232
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
20790357 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 20790259  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
     ||| ||||| || |||||||||||||    
20790258 taaaggaagatacaatatgtttaaaaa 20790232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 39184205 - 39184079
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| ||| ||| ||||||||||||||| | | ||| ||||||| ||||||||||||| ||| |||||||| |||| |||||| ||||| ||    
39184205 atccaatataaactttaaacccacacttgacacatttatacctcttattcaaatttgcaactctctgtgtccataattatgtgatatagtcaaataagat 39184106  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||  | |||||||||||||    
39184105 caaaggaagatgcaatatgtttaaaaa 39184079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 40057816 - 40057690
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||||| ||||| |||| | | ||||||||||| ||||||||||||| ||| | |||||| |||| |||||| ||||| ||    
40057816 atccaatataaatttttaactcacatttgactcatttatacctcctattcaaatttgcaactctctgtgtccctaattatgtgatatagtcaaataagat 40057717  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||  | |||||||||||||    
40057716 caaaggaagatgcaatatgtttaaaaa 40057690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 20935037 - 20935074
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||| |||||||||||||||||    
20935037 tataaaattttaactcacacctgacacattaacatctc 20935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 32976511 - 32976548
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||||||| |||||||||||||    
32976511 tataaaattttaactcacacttgatacattaacatctc 32976548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 42400423 - 42400460
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||||| |||||||||||||||||    
42400423 tataaaattttaactcacacgtgacacattaacatctc 42400460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Original strand, 50332005 - 50332036
171 attttaactcacacttgacacattaacatctc 202  Q
50332005 attttaactcacacttgacacattaacatctc 50332036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 134
Target Start/End: Original strand, 14249271 - 14249303
102 gtcatctcacttatatgttattcataatctact 134  Q
    ||||||||||||||||||| |||||||||||||    
14249271 gtcatctcacttatatgtttttcataatctact 14249303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 17764162 - 17764130
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||| ||||||||||||||    
17764162 aattttaactcacacttgtcacattaacatctc 17764130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 19065482 - 19065450
170 aattttaactcacacttgacacattaacatctc 202  Q
    |||||||||||||||||| ||||||||||||||    
19065482 aattttaactcacacttgtcacattaacatctc 19065450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 6)
Name: chr4

Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 6554725 - 6554451
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| ||||||  |||||||||||||||||||||| |||||||||||||||||| |||    
6554725 ttacactgagttttatcaccatattagactaagagataccatacaattgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatg 6554626  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||||||    ||||               |||||||| |||||||||||||||||||||||||||||||    
6554625 agtcatctcacttatatgttattcaaaatctactctt----ccat---------------ccactatagaattttaactcacacttgacacattaacatc 6554545  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||    
6554544 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatatttaaaaaggttagtta 6554451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 314507 - 314233
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||| |||||||||| ||||||| |||    
314507 ttacactgagttttatcaccatattagactaagagatatcatacaagtgagattgatatcacatattcacacaaaacattaagccagtggtatgtatatg 314408  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||||||||| |||                   |||| ||| ||||||||||||| |||||||||||||||||    
314407 agtcatctcacttatatgttattcaaaatctactcttctat-------------------ccaccatagaattttaactcacgcttgacacattaacatc 314327  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
314326 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 314233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 170 - 285
Target Start/End: Complemental strand, 35696059 - 35695942
170 aattttaactcacacttgacaca--ttaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaag 267  Q
    |||||||||||||||||||||||  |||||||||  |||| |||||||||||||||  ||| ||||||||||||||||  || ||||| || |||||||     
35696059 aattttaactcacacttgacacacattaacatctattatttaagtttgcaactctccgtgtccataattacgtgacatgttcaaataagataaaatgaaa 35695960  T
268 acaccatatgtttaaaaa 285  Q
    ||   |||||||||||||    
35695959 acgtaatatgtttaaaaa 35695942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Complemental strand, 13228732 - 13228701
171 attttaactcacacttgacacattaacatctc 202  Q
13228732 attttaactcacacttgacacattaacatctc 13228701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 137
Target Start/End: Original strand, 24180967 - 24181011
93 tgtaaatgagtcatctcacttatatgttattcataatctactctt 137  Q
    |||| |||||| || ||||||||||||||||||| ||||||||||    
24180967 tgtatatgagttatttcacttatatgttattcatcatctactctt 24181011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 35696184 - 35696136
22 tattagactaagagataccatacaagtgagataaatatcacatattcac 70  Q
    |||||||| |||||||| || |||||||||||  |||||||||||||||    
35696184 tattagaccaagagatatcacacaagtgagattgatatcacatattcac 35696136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0211 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0211

Target: scaffold0211; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 18355 - 18629
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||| | |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||| |||||||||| |||    
18355 ttacactgaattttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagcctgtagtatgtatatg 18454  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||||||||| |||                   |||||||| ||||||||||||||||||||  |||||||||    
18455 agtcatctcacttatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgactaattaacatc 18535  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
18536 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 18629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0114 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0114

Target: scaffold0114; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 37224 - 36954
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||| ||||||||||| |||    
37224 ttacactgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagctagtagtatgtatatg 37125  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    | ||||||||||||||||||||||| ||||||||||| |||                   |||||||| |||||||||||||||||||||||||||||||    
37124 aatcatctcacttatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgacacattaacatc 37044  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttg 290  Q
    || ||||||||||||||||||||| ||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
37043 tcttattcaagtttgcaactctctgtgtccataattacgtgacgtagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttg 36954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 5)
Name: chr5

Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 9025136 - 9024862
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||||||||||||||| |||    
9025136 ttacactgagttttatcaccatattagactaagagataccatacaagtgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatg 9025037  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||                   |||| ||||||||||| |||||||||||||||||||||||||||||||    
9025036 agtcatctcacttatatgttattcaaaatctac-------------------tcttctatccactatataattttaactcacacttgacacattaacatc 9024956  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||| ||||||||||| | | | |||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||    
9024955 tcttattcaattttgcaactctttttatccataattacgtgacatagtcaaataatatcaaacgaagacaccatatgtttaaaaaagttggtta 9024862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 30327039 - 30327164
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
30327039 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 30327137  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
30327138 caaaggaagatacaatatgtttaaaaa 30327164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 286
Target Start/End: Original strand, 23570626 - 23570752
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| ||||||||||| | ||| ||||||||||||| |||||| ||||| ||    
23570626 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactct-tatgttcataattacgtgatatagtcaaataagat 23570724  T
259 caaatgaagacaccatatgtttaaaaag 286  Q
    |||| ||||| || ||||||| ||||||    
23570725 caaaggaagatacaatatgttaaaaaag 23570752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Original strand, 38015979 - 38016010
171 attttaactcacacttgacacattaacatctc 202  Q
38015979 attttaactcacacttgacacattaacatctc 38016010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 285
Target Start/End: Original strand, 27593551 - 27593632
204 tattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    ||||||| ||||||||||| | ||| ||||| || |||| |||||| ||||| |||||| |||||  | |||||||||||||    
27593551 tattcaaatttgcaactctatgtgtccataactatgtgatatagtcaaataagatcaaaggaagatgcaatatgtttaaaaa 27593632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 9)
Name: chr8

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 41526946 - 41527205
13 ttatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatgagtcatctcact 112  Q
    ||||||||||||||||||||||  |||||||||||||||||  |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
41526946 ttatcaccatattagactaaga--taccatacaagtgagattgatatcacatattcacacaaaaccttaagccagtagtatgtatatgagtcatctcact 41527043  T
113 tatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatctcctattcaagt 212  Q
    ||||||||||||| ||||||||||| |||                   |||||||| ||||||||||||||||||||||||||| ||||| |||||||||    
41527044 tatatgttattcaaaatctactcttctat-------------------ccactatagaattttaactcacacttgacacattaatatctcttattcaagt 41527124  T
213 ttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtt 293  Q
    |||||||||||| ||| ||||||||||||||||||||  ||||||||||||||||||||||||| ||||||||||||||||    
41527125 ttgcaactctctgtgttcataattacgtgacatagtcagataatatcaaatgaagacaccatatatttaaaaaggttggtt 41527205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 361092 - 360967
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
361092 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 360994  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
360993 caaaagaagatacaatatgtttaaaaa 360967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 165 - 285
Target Start/End: Complemental strand, 40886896 - 40886775
165 tataaaattttaactcacactt-gacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaat 263  Q
    |||||| ||||||||||||||| |||||||| | | ||| ||||||| ||||||||||||| ||| || ||||| |||| |||||| ||||| ||||||     
40886896 tataaatttttaactcacacttagacacatttatacctcttattcaaatttgcaactctctgtgtccacaattatgtgatatagtcaaataagatcaaag 40886797  T
264 gaagacaccatatgtttaaaaa 285  Q
    |||||  | |||||||||||||    
40886796 gaagatgcaatatgtttaaaaa 40886775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 45245358 - 45245232
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| ||||||||||||||||||||||| |   ||| ||||||  ||||||||||| | | | |||||||| |||| |||||  ||||| ||    
45245358 atccaatataaatttttaactcacacttgacacatttattcctcttattcagatttgcaactctttgtatccataattatgtgatatagttaaataagat 45245259  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| |||||    |||||||||||||    
45245258 caaaggaagatgtaatatgtttaaaaa 45245232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 202
Target Start/End: Complemental strand, 38290578 - 38290543
167 taaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||| ||||||||||||||||||||||||||||    
38290578 taaaattataactcacacttgacacattaacatctc 38290543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 147 - 197
Target Start/End: Complemental strand, 17871294 - 17871244
147 atttactcttatatccactataaaattttaactcacacttgacacattaac 197  Q
    ||||||||||| || || | ||||| |||||||||||||||||||||||||    
17871294 atttactcttacattcaatgtaaaactttaactcacacttgacacattaac 17871244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 201
Target Start/End: Original strand, 42797332 - 42797362
171 attttaactcacacttgacacattaacatct 201  Q
42797332 attttaactcacacttgacacattaacatct 42797362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 199
Target Start/End: Complemental strand, 13756576 - 13756548
171 attttaactcacacttgacacattaacat 199  Q
13756576 attttaactcacacttgacacattaacat 13756548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 199
Target Start/End: Complemental strand, 14373940 - 14373895
152 ctcttatatccactataaaattttaactcacacttgacacattaacat 199  Q
    |||||||||||| | |||||||||||||  ||||||||||||||||||    
14373940 ctcttatatccaatttaaaattttaact--cacttgacacattaacat 14373895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 7)
Name: chr2

Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 31965745 - 31966017
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| |||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||| ||||| || ||||||||| |||    
31965745 ttacactgagttttatcaccatattagactaagagatatcatacaagtgagattgatatcacatattcacacaaaaccttaagtcaatagtatgtatatg 31965844  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
      ||||||||||||||||||||||| ||||||||||| |||                   | |||||| |||||||||||| ||||||||||||||| ||    
31965845 --tcatctcacttatatgttattcaaaatctactcttctat-------------------ctactatagaattttaactcatacttgacacattaacttc 31965923  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    || ||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31965924 tcttattcaagtttgcaactctctgtgtccataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 31966017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 19040743 - 19040706
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
19040743 tataaaattttaactcacacttgacacattaacatctc 19040706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 39839128 - 39839165
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
39839128 tataaaattttaactcacacttgacacattaacatctc 39839165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 36720107 - 36720075
170 aattttaactcacacttgacacattaacatctc 202  Q
36720107 aattttaactcacacttgacacattaacatctc 36720075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 14905154 - 14905103
150 tactcttatatccactataaaattttaactcacacttgacacattaacatct 201  Q
    |||||||  ||||| ||||||| ||||||||||||||||||||| |||||||    
14905154 tactctttcatccaatataaaactttaactcacacttgacacatcaacatct 14905103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 285
Target Start/End: Complemental strand, 24969048 - 24968967
204 tattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    ||||||| ||||||||||| | ||| |||||||| || | |||||| ||||| |||||| |||||  | |||||||||||||    
24969048 tattcaaatttgcaactctatgtgtccataattatgtaatatagtcaaataagatcaaaggaagatgcaatatgtttaaaaa 24968967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 45054785 - 45054830
92 atgtaaatgagtcatctcacttatatgttattcataatctactctt 137  Q
    ||||| ||||||||| |||||| |||||||||||| ||||||||||    
45054785 atgtatatgagtcatttcacttgtatgttattcatgatctactctt 45054830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 11)
Name: chr1

Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 49881987 - 49881712
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||||  |||||||||||||||||||||| |||||||| ||||||||| |||    
49881987 ttacactgagttttatcaccatattagactacgagataccatacaagtgagattgatatcacatattcacacaaaaccttaagccaatagtatgtatatg 49881888  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| ||||| ||||| ||||||                 |  |||| |||||||||| |||||| |||||||||||||    
49881887 agtcatctcacttatatgttattcaaaatcttctcttctatcca-----------------ctatatagaattttaacttacacttaacacattaacatc 49881805  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtt 293  Q
     | ||||||||||||||||||||| ||| ||| ||||| |||||||||| ||||||||||||||||||||||||| |||||||| ||||||||    
49881804 gcttattcaagtttgcaactctctgtgtccatgattacatgacatagtcaaataatatcaaatgaagacaccatacgtttaaaacggttggtt 49881712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 19102761 - 19102886
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||| ||||||| |||||||||||| |||| ||||||||||||| |||||| ||||| ||    
19102761 atccaatataaatttttaactcatacttgacacattaacacctcttattcaaatttgcaactctc-ctgttcataattacgtgatatagtcaaataagat 19102859  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
19102860 caaaggaagatacaatatgtttaaaaa 19102886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 45918340 - 45918404
230 cataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaaggttggtta 294  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||    
45918340 cataattacgtgacatagtcaaataatatcaaatgaagacaccatatgtttaaaaaggttagtta 45918404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 21467720 - 21467845
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| |||||||| ||||||| ||| ||||||| |||| |||||||  ||| ||||||||||||| |||||| ||||| ||    
21467720 atccaatataaatttttaactcatacttgacaaattaacacctcttattcaaatttgtaactctca-tgttcataattacgtgatatagtcaaataagat 21467818  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| || |||||||||||||    
21467819 caaaggaagatacaatatgtttaaaaa 21467845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 1992468 - 1992431
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
1992468 tataaaattttaactcacacttgacacattaacatctc 1992431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 20306773 - 20306810
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
20306773 tataaaattttaactcacacttgacacattaacatctc 20306810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 40946565 - 40946528
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
40946565 tataaaattttaactcacacttgacacattaacatctc 40946528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 30001782 - 30001819
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||| ||||||||||||||||||||||    
30001782 tataaaattttaacttacacttgacacattaacatctc 30001819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 202
Target Start/End: Original strand, 43387145 - 43387177
170 aattttaactcacacttgacacattaacatctc 202  Q
43387145 aattttaactcacacttgacacattaacatctc 43387177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 202
Target Start/End: Complemental strand, 3982760 - 3982731
173 tttaactcacacttgacacattaacatctc 202  Q
3982760 tttaactcacacttgacacattaacatctc 3982731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 173 - 201
Target Start/End: Complemental strand, 47783184 - 47783156
173 tttaactcacacttgacacattaacatct 201  Q
47783184 tttaactcacacttgacacattaacatct 47783156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0284 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: scaffold0284

Target: scaffold0284; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 731 - 996
1 ttacactgagtattatcaccatattagactaagagataccatacaagtgagataaatatcacatattcacacaaaactttaagccagtagtatgtaaatg 100  Q
    ||||| ||||| |||||||||||||||||||||||||| |||| |||||| ||  |||||||||||||||||||||  ||||||||||| |||||| |||    
731 ttacattgagttttatcaccatattagactaagagatatcataaaagtgatattgatatcacatattcacacaaaatcttaagccagtaatatgtatatg 830  T
101 agtcatctcacttatatgttattcataatctactcttatatccataatttactcttatatccactataaaattttaactcacacttgacacattaacatc 200  Q
    ||||||||||||||||||||||||| |||||||                   |||| ||||||||||| || ||| ||||||||||||||||||||||||    
831 agtcatctcacttatatgttattcaaaatctac-------------------tcttctatccactatagaacttttactcacacttgacacattaacatc 911  T
201 tcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatatcaaatgaagacaccatatgtttaaaaa 285  Q
    || ||||||| ||||||||||||| ||| ||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||    
912 tcttattcaaatttgcaactctctgtgtccataattacatgacatagtcaaataatatcaaatcaagacaccatatgtttaaaaa 996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 8)
Name: chr6

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 285
Target Start/End: Complemental strand, 21986315 - 21986190
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| |||||| |||||||||| ||||||||||| |||| ||| ||||||| |||||||||||| |||| ||||||||| ||| |||||| ||||| ||    
21986315 atccaatataaatttttaactcatacttgacacatcaacacctcttattcaaatttgcaactctc-ctgttcataattacatgatatagtcaaataagat 21986217  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    |||| ||||| ||  ||||||||||||    
21986216 caaaggaagatacagtatgtttaaaaa 21986190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 285
Target Start/End: Original strand, 33348201 - 33348326
159 atccactataaaattttaactcacacttgacacattaacatctcctattcaagtttgcaactctctctgtacataattacgtgacatagtcgaataatat 258  Q
    ||||| ||||||  ||||||||| |||||||||||||| | ||| ||||||| ||||||||||||  ||| ||||||||||||| |||||| ||||| ||    
33348201 atccaatataaatatttaactcatacttgacacattaatacctcttattcaaatttgcaactctc-atgttcataattacgtgatatagtcaaataagat 33348299  T
259 caaatgaagacaccatatgtttaaaaa 285  Q
    | || ||||| || |||||||||||||    
33348300 cgaaggaagatacaatatgtttaaaaa 33348326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 7428525 - 7428562
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
7428525 tataaaattttaactcacacttgacacattaacatctc 7428562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Original strand, 16279120 - 16279156
165 tataaaattttaactcacacttgacacattaacatct 201  Q
    ||||||||||||||| |||||||||||||||||||||    
16279120 tataaaattttaacttacacttgacacattaacatct 16279156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 28365771 - 28365735
165 tataaaattttaactcacacttgacacattaacatct 201  Q
    ||||||||||||||| |||||||||||||||||||||    
28365771 tataaaattttaacttacacttgacacattaacatct 28365735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 171 - 202
Target Start/End: Complemental strand, 1599722 - 1599691
171 attttaactcacacttgacacattaacatctc 202  Q
1599722 attttaactcacacttgacacattaacatctc 1599691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 9449661 - 9449706
175 taactcacacttgacacattaacatctcctattcaagtttgcaact 220  Q
    ||||||||||||||||| |||||||||| || |||||| |||||||    
9449661 taactcacacttgacacgttaacatctcttaatcaagtgtgcaact 9449706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 16705671 - 16705606
147 atttactcttatatccactataaaattttaactcacacttgacacattaacatctcctattcaagt 212  Q
    ||||||||||| ||||| ||| ||| || |||||||  |||||||||||||||||  |||||||||    
16705671 atttactcttaaatccattatgaaacttcaactcacgtttgacacattaacatcttttattcaagt 16705606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1345 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1345

Target: scaffold1345; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 1894 - 1857
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
1894 tataaaattttaactcacacttgacacattaacatctc 1857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 43989728 - 43989691
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
43989728 tataaaattttaactcacacttgacacattaacatctc 43989691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 132
Target Start/End: Complemental strand, 6198521 - 6198481
92 atgtaaatgagtcatctcacttatatgttattcataatcta 132  Q
    ||||| ||||||||| ||||||||||||||||||| |||||    
6198521 atgtatatgagtcatttcacttatatgttattcatcatcta 6198481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1750 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1750

Target: scaffold1750; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 324 - 361
165 tataaaattttaactcacacttgacacattaacatctc 202  Q
    ||||||||||||||||||||||| ||||||||||||||    
324 tataaaattttaactcacacttgccacattaacatctc 361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191907 times since January 2019
Visitors: 2831